GenePrediction:GLEAN_7551 Details

Name: GLEAN_7551
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1354305..1351545 (- strand)
Length: 2761
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1354305..1353909 (- strand)
Length: 397
Type: CDS
Source: GLEAN
Position: GCSC_140:1353524..1353245 (- strand)
Length: 280
Type: CDS
Source: GLEAN
Position: GCSC_140:1353178..1352955 (- strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_140:1352898..1352765 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_140:1352695..1352655 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_140:1352603..1352552 (- strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_140:1352496..1352343 (- strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_140:1352289..1351750 (- strand)
Length: 540
Type: CDS
Source: GLEAN
Position: GCSC_140:1351696..1351545 (- strand)
Length: 152
>GLEAN_7551 class=GenePrediction position=GCSC_140:1354305..1351545 (- strand)
ATGTCGGACCCGTACCAGATCCCGCCATCGGCCTTCCAGGACGACCCGACGTCGAACCTGTCGGGCTTCAACCTGCGGCG
GTCCTCATATGCCTCTGTCGCGTCAGGTCCGGGCAGCTTTGCGCGGTCCGGTGCCAATTTTGCCCAGCTGTTGAATCCGA
CCAGCAGCGTGACCGTTGACGGATCCGACGGCAGCGGCAACGGTGCCAGCAACATCAACAGCTCCAGCAGCCTGCGGGGT
CCATATGGAGCCGATACAGAGGGGCGTGGTTCCTTTGAGGCCTCGGGTGGCGGCCTGTACCAGATTCTGGGAACCCGCAA
CACGCAGCTGCCGTCGTTCTCGCATGCCTTTGAGCACCTGCTGTGCGCCCCGCCCTTTGAGACGTACACGACGGCAAGTG
TTCCAAGAAACATTGGTTTCTTCACGCCGTCGTACCTGCGCGATTCCGTCTACGTCCAGCGACTGGAGAGCCAATACGAG
GCCAAGCTGCAGGCCCAGCGGGAGAGCCAGCACCAGCAGCAGCACCAGCAGTACCAGCAGCAGCACCACCAACAGCAGCG
ACACCCGCAGTCGGCGGCCATAGCAGCAGCAACCGCCGCTGCCGGTGGCATCATCGGGGGCGCCGTCCTCACAGGGAGCA
GCAGCGTGGTCGGCAGCGGCCTGGCAAGCCACGGTAGCGGCCAAAGCTTGTATGGCAGCAGTGTCGGAGGTGTTGCCGGC
ATCGGCAACAGCGGCGGTGGCAACAACAGCAGCAGCAAGCCTGGCCCACCATCGTACCGAGGTATGGCGTTCGACGTGGT
GGAGAAGAGCCCAGGCACGGCCCTGTTGGACGACGACGAGGCGATGACGCCGCTGCCGTCGCGCTGGGACAAGAAGGACA
AGCCGCAGTCGGGGCTGGAAGTGCTCTCGGGCGGTCTGGACGTCAAGTACATGGCCTCGTCGCTCAAGGGTACGGGCGAC
CGCGAGCAGGACCTCTGCTCCATCCGTGCCGACCACTACATGCCACCGCAGTGCGGCATATACTACTTTGAGGTGACCGT
GCTGGGCAAGCACAAGGGAGAGTGAGTAGTGGCGGCTGTGTCTCTCGTTCTTGTAGTTGTGCAGTACTGACGCTGCTTAC
TTAAAAGGTCGACGGTTGGGATCGGCTTCTCGGACGCCTCGGCGTCGTTGACACGGCAGCCGGGATGGGAGCCAAAGTCA
TGGGGATACCACAGCGACGACGGAAACATATTTTATGCGAACAGCCAGGGGAAGTCGTATGGGCCACCATTTGGGCCTGG
CGATGTCGTCGGCTGTGGCGTGAACTTCCGGACGGGGGCTGCCTTTTACACGAAAAACGGCGAAAATCAGGGTTGGTGGT
ACTCCTGCTTTTCTCCTCCTTGCTTCACTTGCTAAACAGTCCTGCAGGTGTGGCCTTTCCAGATATCAGGGGAAGCAATC
TGAAGCTCTTCCCCACTGTCGGTCTGAAGAAGTCGGGCGAGCACATTCGCGTCAACTTTGGCCAGTCGCCTTTCACCTTT
GATATCGACGGCATGATGAAGGTAAGTTGTCTTTGCTCACGGCGTATGCACCCTGGTTTTTTTCTCCACGCTGACTCTTC
AATGCTGCAGGAGGAACGAAACCTCATCGATGCTCAGATAAGAAACACAGGGTAGGTCATGACGCCATGTATACGTATTT
GCGCTGGGCTGACACTTTGTAGTACAAAGGGTCTTGCACCACATCTGGGCGAGACGGAGCTTATTCAACAATTGGTACGT
CTTCTAGAACGAAGGACCGGCTTGGCCGGCAATTTGTTAACATGCCTAGGTTCTGCAATTCCTGCAACATGATGGCTACG
TTGAAACAGCGCGAGCGTTTGCCGATGAAATCCGGGAGGAGAAGGCGTCTCTGAACTTGAATCCTGCCAACGTGGTGAAA
GGAATCAGCATTACTGATGACGAGGATGCCAACAACCGTCAACGTCGGTTCCCTCCCTGACAAGCCAAAGCAAGCACCGA
GCTGACAGCCAGATAGGAATCCGAAGAGCGATCTTGGAAGGTGACATTGACCGGGCTCTCAAGCTGACCAAGTTCTACTA
CCCCCATGTGCTCGAGGCCAATGAACAGGTGTACTTCCGGCTGCGATGCAGGAAGTTTGTGGAGATGATCCGCAAAGAGG
CCGAGCTGAACCTGGTGGGCAGAAGCAGCAGCAGCAACGGCGGCATCAGCACTGCCAGCGCGGTCGTGAGCGGCAGCGGC
AAGCAGAGCAACGGCCGTGGCCGCACAGACAGCCACCTTTCGCAGCAGGACATGGACATTGACGATATCGACATGGTCGA
GGACGGCACAGACGGGCTGCCGCCGAGTCAGTCAGTAGTAGACGAGGCCATTGCGTATGGCCAGGCGCTGCAATCGGAAT
ACATTAATGATGCGCGAAGCGAGATTCGCAGTGCTCTGGGCGAGATCTTTTCGCTGCTGGCCTACACCAACCCGCTCAAG
GAAAAGGGGGTGGCACATCTCTTGGACCAGCGGGGACGCGTTGCTGTTGCCGAGGAGCTGAACTCGGCGATATTGCGTAT
GTATCACGTCTTGTGTGCTCTGGTCTTCTCTCGAAGCTAACGTCGTCAGAATCTCTCGGCAAGTCATCGCGTGCTGCTCT
GGAGAACCTGTATGCCCAGACCAGCGTTCTGCTGGAAGACATCCGCCAAGACGGCGGGCCGGGATCGTTTGTCACCATCC
AGGGAGTTGTCGACCGGATCCCGTCCTCATCCAACTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62