GenePrediction:GLEAN_7552 Details

Name: GLEAN_7552
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1348421..1345918 (- strand)
Length: 2504
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1348421..1348032 (- strand)
Length: 390
Type: CDS
Source: GLEAN
Position: GCSC_140:1347979..1346771 (- strand)
Length: 1209
Type: CDS
Source: GLEAN
Position: GCSC_140:1346613..1345918 (- strand)
Length: 696
>GLEAN_7552 class=GenePrediction position=GCSC_140:1348421..1345918 (- strand)
ATGGCCTTTGGACGAGCCCAAGAAGACCGGCCAACGCCGCCACAGGTCTACAACTGGCGCATCTATGCGGTGTCGCTCTG
TGCAACTCTCGGTGCGTATCTCTTCTACCGCTTCCAGGCCGCTCTGGCTGACTCGCCAGGCTCGTGGATGTTTGGCTACA
ACAATGCGGTCATCGGCGGCTGCATGGTGCTGCCGGCCTTTGTGCGTGACTTTGACCTGCCGCCGGCCGACAGCTCGCGC
TACACCGACATCACGTCCAACATTGTGTCGTTTGTGCAGATTGGCGCCATTGTCGGCAGTCTGCTGGTCTTTCCTGTGCT
CAAGTCGTGGGGCCGCCGGTCGGCCCTGGCACTTTCGGGGGTCGTCTTTTTCATCGGATGTGCAATGCAGGTGCGTTGGG
ACCTCTCGACCTCTATCCTTCTGCCTTTATCCTGACCACCAGACCTTCTCTGGCGGCCGTCTCAGCCTCATGTATGCCGG
CCGGGCACTCAGTGGCGTCGGGCTCGGCTGCGTCACCGTGTCGGTGCCCATGTACATTGGCGAGCTGTCGCCGGTGGCCA
TCCGCGGATCCCTGATCGGCCTCTACGAGATCAACAACCAGCTGTCGTCTTTCTGGGGCTTCTGGGTCAACTACTTCACC
ATCATCGGCGTGCCGGCCAGCCAGTCGCGCCAGTGGCAGATCCCGTTGGCCATGCAGATGATCCCGGCCGGCCTGTTGTG
CCTTGCTGCTGCCATTGGTCTGCCCGAGTCGCCGCGCTGGCTGGTCGAGCATGATCGCAGCGACGAGGCCCGTCGGGTGC
TCGCCTTTCTGCGCCAGCTCGACCCCCAGCATGAATACATCTGCTTCGAGATCGATCGTGCCGAAGAGGCTCTCGCGCGT
CAGCGTCGTCTGCGTGCCAAGCAGAGCCGCTGGCAGGTCGTGCGTGAGCTCGCGTGGCCCGGCAACCGCAATCGACTCCT
GCTCGGCTGTCTGTTGATGTGGTGTGCCAATCTGACCGGCGGCATCGGTGTCAATGCCTATGCGCCCGCCATCTTCCAGT
CCATCGGCATTCGCGGCACCGCTCGCCACCTCTTTCTCTCCGGCTTCTACTCGCTCGCCCGTGTCATCACTACCGCCCTC
GGCCTGCTCTTCTTCATCGACAAGGCCGGCCGCCGCGTCCTTTTGCTCGTCGCCACCGCCGGCGTCGTCCTCTCGCTCGG
CTATATCGCCATCTTCAACACCGTCTCCGTTCACGAGTCCGACAAGGGTTCTGCCGGTGTCGTCGCCGTCGTCGCCGTCT
ATGCCTTTGCTGTGAGCTACTCGGCCGGCTGGACCGGTGTCCCCTGGGTCTACTGCGCCGAGATCTTTCCCGCCCGCATC
AAGGATATGGCCGTCTGCATCACCACCTGGAACCAGTGGATCGCCCAGTTCGTCGTCTCTCGCCTGACCCCCTACATGAT
TGCCGCCACGCCGAGCGGCAACGTCCTCTTCTTCGTCTATTCCGGCATCACCATCTGCTCCGGCTTCTTCGTCTACTTCT
TCGTCCCGGAAACCCGTGGCAAGACGCTCGAGGACATGGACGACATATTTGGCACGCCCTACAAGGATGGCGAAGGCACT
GCTGCCATGGCCAATCCCATGGTCCAAGAACTGGCAAGAGTCCCGACAAACGTATGAGTGCACGACGCTTCCTGCTGCAT
AAGCTGGACCATGATAATGATAATGTATATAGAATGTAATACGTAATTGCTTTTACTTTACTCAGAGCACAATCAACTTG
TAGATCACGTGATGTGTCACATGACTCAAAATACATCAATGCTCCCAGCCCTCCTTTCGCCCTTCTCACCATCACGACCA
ACGTCTGCACAACATGGCCACCCCCGAAGCGCAGGCCGCGCTGGTGGCGCACCAGGCCCTCCTGGAGGAGCTCGACATTC
ACGCGGTCCACAAGACCTTTCGCAACCCGCTCTGGCGGCCGAACCAGCGCCGCAACAAGAACATCAAGACCATTCTGGGC
GACGCGTCCCGCAAAGAGGCCTCGGCCGCGGCCACGCCACAGGACAACAGCGGTGCCAACACGCCCAGCAGAGGCCTGAT
CGTACCGACGACAGCCGCTGCTGTGAAGGGCAACGACGACGCCTTGTCGACCAACGGTGCGACGACGCCGGCCATTGTCG
CCGGCGGTGGCGCCTCTTCCGCCACCGGAGACGGCAGCCTCTTGGCTCAGGCCAATCGCAGTCTCTCGAAGCTCGTGCTG
GAGAAGAGCCTGCGGCCGGCGTCGACGGCCGGCAGCCTAGGTACGGCGGCACCAACGGTCACGTATACCAACATCGAGAG
CGCGCCCAGCCTGGCGCCTCAGCGACGCTACTGCGACATCACTGGCCTCAACGCGCCCTACACCGATCCCAAAACCCGGC
TGCGGTACCACAACAGCGAGGTGTTTGCCAGCATCCGCGGCTTCCAGCAGGGCGTGGCCGAACAGTATCTGGAGATGCGG
GGGGCCCACACCGTCCTCAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62