GenePrediction:GLEAN_7553 Details

Name: GLEAN_7553
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1344938..1343941 (- strand)
Length: 998
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1344938..1344918 (- strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_140:1344836..1344751 (- strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_140:1344672..1344628 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_140:1344563..1344521 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_140:1344465..1344398 (- strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_140:1344336..1344044 (- strand)
Length: 293
Type: CDS
Source: GLEAN
Position: GCSC_140:1343981..1343941 (- strand)
Length: 41
>GLEAN_7553 class=GenePrediction position=GCSC_140:1344938..1343941 (- strand)
ATGAAGCTGTACTACCTTGGGGTAGGCATCATGAACTGCAGACGGCTGAGGCCAGAGGGGCGAGGAACCGCTTTTTGCTG
ACCCGCGTGCCCGTCTCCATAGATTATCCGCAATGACGGCCCGCAGCAGTCGACGGAGCTGATTGCCGAGAAGGAGCTGA
ACGAGTACTCCCGATTCACGCGGGGAAGGTATGACGACAGACGAATTGGGGCGCCAAATGGCTTGGCTATGGGAACATGA
GGCTGACTGCAGTGGCATTTCTGCAGCGTCGGCGAGTTCATGACGGTCTTTTCGCGGACCGTGGCCGAGAGGTAGGTCTG
GCCCCGGACCGTGTGCCTCTGGCCCGAAACCAGCTCTGACCAGACCGTCTTGCAGAACGAAGCCCGGACAGCGCCAGGAT
ATTGAGCAGGACACCTACGTGAGTGCGGCCCGGCTGGAAAGAGAGACCTCCCTTGCTGACACCGTCTTGCCAGACGTTCC
ATGCCTACGGCCGAAGTGAGGGCATTACTGGCATCATCATCAGCGACCATGCGTACCCTGCGTAAGTTCCTGTGATACTG
CAGTGCCCTCTCCTTCAGCTACATTACTGACTTCCTTTGCAGCCTCGTTGCGCACCAGCTCCTCGGAAAGATCGTCGATG
AGTTCCTCGCACAACAGCCACGCTCGGCCTGGGCCACAGGCACACCGACACTGTCCATGCCCGAGCTCAAGAACTACCTG
GCCAAGTACCAGGACCCACAGCAGGCCGACAGCATCATGAAGATCCAGCAGCAGCTGGACGAGACCAAGATCGTGCTGCA
CAAGACTATCGAGAGCGTGCTGCAGCGGGGTGAAAAGCTCGACGAGCTGGTGGCCAAGAGCGACAGCTTGAGCAATCAGA
GCAAAATGTTCTATAGTACGTTTTACCCTTTCTCTGCCTCCTCTTCCCCTACTGCTCACATACTGACCATCGCCCAGCCC
AAGCAAAGAAGCAGAACTCGTGCTGCGTCGTTATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62