GenePrediction:GLEAN_7554 Details

Name: GLEAN_7554
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1337265..1336422 (- strand)
Length: 844
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1337265..1337192 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_140:1336797..1336422 (- strand)
Length: 376
>GLEAN_7554 class=GenePrediction position=GCSC_140:1337265..1336422 (- strand)
ATGACCTCTGCTCGGGCCAGACAGCTGCAGGAGAATAGCGGAAGCGACAGCCAAGAGGCCAAAGCTCTCGCGTTGTCAGT
GCCGTCGTTGTTCCGACGTCGCGACTAAGGAAAGGCAAAGCAAAAAAAAAACCCCCCCCAGGCCGGAAGGAGTCGAGATC
GAAAGGTGACGAGAGGTGGCGGCTTACGCATGTTTCGTCCGCTTCCTTTGTGGGCTGGCTGGCTGGCGTGCGGGTGCCGT
GGGCCAACAGCTGATTTTCTGACTTTTTTGTTCTTTTCCATGCTCTGTCTTCTTGCTTTCTCGTTTTCTCGGCTTCCCCC
GTCGTTTTTCCTCACTGCCGGCTCTGCGGAAGAGCTAATGCCATAGTAGTCTCGGCCCTGTCTACTCGGTCCCAGTCCGG
CAATACTCGTCGTCGAAACCCTGCCGTCGATTCGCTCGCTCTATTGCTTTGTGTGCCCATTTTTCTAGGCCTGTCCCCAG
TCCCCGATCAGCGCTCTCCCGAGGTTTGGCCGGCCACGACGCCAGCCAGGGCCGCTATCTTCCTGGCGACAACGCCATGG
TGGGCGCATCTGCTGTACAAGTAGAATCTGCTCGCCCTTCCCGCCTCTCTGCTCTTGCCGTGTCCAACTTTGCCGTGTCG
CTCTTGCCGTGTCGCTGCCGCACTGCTCTCCGTCTCGATTCGCTCTCTCTGCCTTCTCTCCTGCCACGTGAGATTACTGA
ACCGCCCCACGTCTTCTCTCCACCAACAACCGCTGTCCGAAATCAGTCGACACCACAATACCCGTCGGCCACTGAAGCAG
CCGCGGCTTGCACATGCAGCACGGGTCCAACTTTTGCAAATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62