GenePrediction:GLEAN_7556 Details

Name: GLEAN_7556
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1334820..1334471 (- strand)
Length: 350
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1334820..1334724 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_140:1334628..1334471 (- strand)
Length: 158
>GLEAN_7556 class=GenePrediction position=GCSC_140:1334820..1334471 (- strand)
ATGTCCAAGTCCTTCACACCGGCCGACGTGGCCAAGCACAAGACCGACGCGGATGGCCTCTACGTCATCATCGACGGCGG
CGTGTACAACGTGACAGGTGAGTGCGCCGAGGACGAGGACGGAGGGCAGAGGGTGTCGAGGAAAAGACTGCTGGAACGGC
TGCGCTGACCGAGGCCATCTTGAGCCAACCAGACTTTGTCGAGGAGCACCCGGGAGGCGAGAAGATCCTACGCCGCATGG
CTGGCCGTGATGCCAGCAAGGCGTTCTGGAAGTACCACAGCGCCAAGGTGCTGGACAAGTATTCCGAGCGGCTCAAGGTG
GGCACGCTGGCCGAGAGCGCGAAGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62