GenePrediction:GLEAN_7558 Details

Name: GLEAN_7558
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1318404..1318186 (- strand)
Length: 219
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1318404..1318186 (- strand)
Length: 219
>GLEAN_7558 class=GenePrediction position=GCSC_140:1318404..1318186 (- strand)
ATGTATATGGAGTATATGCAAGCAGGAACGACCTCTCTCTCCATCCTGATCCTCACCGGCCACACCGGCCTGGTGGAGAC
AGGAAACAAAGACGAGACGTTCAGCGGCGACAGCCGCGTAGCATCGCTCTCTAGCCGCAGCGATCTGCATCACCCGCTGC
CCAACACGGCCGTTCAAGCCCGGGCTGGCCATGCTGCGCCCTGGCTGTGTTCTGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62