GenePrediction:GLEAN_7559 Details

Name: GLEAN_7559
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1316092..1313291 (- strand)
Length: 2802
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1316092..1313291 (- strand)
Length: 2802
>GLEAN_7559 class=GenePrediction position=GCSC_140:1316092..1313291 (- strand)
ATGGGGCAACAATACGACTTCGAGATGGCAGGGCAGCAGGGCCAGCCGCTTATTGGCATCCTTGGTGCCAGTGTCAATGT
CCACGGCATGTCCATGGCTCAGGACCCGGCTGCCTACTTTGCCCAGCTGATGACGATAGGCAACGGCTCCATACCCACGA
TGCCCTCTCCAGCCGCCACGACATCCGATTCCTCGAGTCCTGCCCTGGCGATAATGGCCCCGGGGAACAGCAGCGGAGGC
ATGAGTCAAGAGCAGGAGCAATTGCTCCGTGAAAACATCTTTCTGCAGCGACAGCTCCTCCTTCTTCAACAACAGCAGCA
GCAACAGCAACAGCAACAGCAACAGCAACGGCTTCTCCCTGCCCAGTACCTTCAGCAGCAGCCAGCCCTGTCTCCCGTGT
ACCTGGAACAGTTCAATGCCCAAATAGCAGCAACAACGACAGCGACAATAGCCGCAGAAACGGCAGGACTATCGATTGAC
AGGGCTAGCCAGGATGGGATTGGGCAGCCGTTGCAGCATGACGGTCAGCTGCCACAAAGAACAGCCCCTTCCGTTGCCTG
GCCCCACCACCATCAAACCCAACATACCCTCCAGCAGACAGCTGCCAACGGCACTGTCCAGGATAGGAATCAAAACGCCC
CAGGGGCCGTCGTCACCAGGCTGGCCACACGTGTTGGTGCGACGAGGGAGGGTGGTGTTCTGGCCAATGTCGAACAGCTT
CGACTCGTAGATCTCTCGACAGTGCATCCGTCCTCTGAGGATGTGTCGTGTGTGCCAATCTCCGCATCCATCCCATCTTC
TGACAGCACGGCTACTATAACTGGACCTCAATCCCCTCTCTCGTCTGCCTCTCCGTCGCGGCCTCCTTCGCATCAATACT
CACAACCCCAGCTTCAGTCTCATCTTCGTCCTCATCCCCAACTTCAGCTTCATCTTCACCCATCTGAGCTTCAGCTGCAC
CCTCCTGCTGACTCTCCCATTTACGCTCACTCCGCCTCGTCCTGTTCGGATCTACCCCTCCAGCATCCCAAGCCTCACCA
TCCGCAGCAACAGCAAGCTCTCTGTGCTCTTGCCTCCTCGTCTGTTCAGCCTGACATTTCTGTCTCCTCCGGCTCCTCTG
TCCTCTCACCTCACAAGACGGCTGTAATGCCATCTGCTGCGTCGTCTTCACCCTCCAAGAAGCTTGGCCGCCTCGAGAGC
ATCTACGCTACAATTCGCAAGGCCACCAACATGCGCCGCTCGCGCGCCTTACTCGAGGAGGCTCACGCCCAGCCGATCAC
AGTGGCACCTATGGCCACGCTGCGCCACGCTGATGGCAGCAACATCAACGCTATCACGCACAAGCACAATCCTGATCATC
TGGATCACTCCAACCTTGCCGCCACTGTGGCGCCGTCGTCTATGCCGACGCCGCCGCTGACAGGCACCGGTTCCATGTCC
TCTGTTTCATCTTCACTCTCATCACTGTCATCGTCCTTTGCCGAGAGGGGTCCGTCTCCCCTGCAAAACATGTACCTGCA
GCAGGAACACAAGCCGCTCGAGGCTTCTTCAGAGGACTTTGCTTTTGTCTCAGGTCTCGTGGACGACCCCTTTGTGGACA
ACAAAGCTTATCTTGCTGCACAGCAGCAAATGATGGCCGTGGGTCAATATGGAAAACCGCTGCCAGATGTCAGCGCGCCA
ACTGCCAGCACCAGCGGCCTGCCACTCTCGCCCACCGCGTACCTGGCCGATGCTACAGCGGCCATGTCGGGCACATCCGT
CATTGCTGCTGCACATGCGGCACATATGGCCGCAGCCGCAAGGTGTGATGCAGCGATCGCTCGAGCTCAAGCTGCACCCT
CATCCGAGATGGACATGGACGAGGACTGGTGGCATCAGTCCGTGGTAGAATCAGCCGTCGACAATAAATCCTCGCTATCA
GCAGTTGACAGCGGTGATGCTGCTGGGGATCCGAACAGCAACACTGGACTAAATACGGCGATCCACATGCAGCAGCTGCA
GCAGTATGATTACCAGCAGCAGGGTGACAGCTACGGCGACGTTAACATGGCCATGGGTGGGCTGATGATCATGCAACCAA
GCCACCAGCAGAGTCACCAGCAGAGCCAGATCCAGAACCAGCATTACTTCCCAGCGGCAGCCATTGAGATGCATCGGTTA
ATGCATGGCGGCTATGACGTTGCTGTCGTGCCGCCACCGCCGCCGATGCCATCCGACCGTGAAAGCCGATACGACCGCCA
CCGCCGTCCGAAGCCGCGAGCACCATCGGCTGGTGCCCGTCACCACGGAGGCGGCAGTTTGTCGCCGCGGAAGCGACGGT
CGTCCCACGAGGACAGCGGCCACATCTCCAGCGGCAGCGGCAGTGGCAGCGTTCCCAGCACGCCCCGAACAGAGCGTCGG
ACACACTCCATGAACGCGCTCTCAAGAGCGTCGCCATCACCGGCCGTAGCAGCGGCGACCCCGTCGTCAACGGCTGTGCG
CAAGCGCCGCTCGGTGAGCAACATGCGCCGGATATCGTCAGGAAGCTCGGTAGGCGCAGAGCCACGGACACCGTTGGGCG
CCCGGAGACGACAAGCACCGTCGGTAGAGGCACAACGGCCCGCCAGCCCTTCGGAAGGCGAGATCGGCTTTGTCAATTTA
TCGATCGAAGACCACGACAAGATCATGGCGAGTGTAGCGCCCAGTGGGTCGTCCAAGACCAAGGCACGACGCGAACGGGA
ACAGTTTGAGCGGGAATGCCTGCTTGTGCAGCAGGCCGAAGAGCTGGCACGGCTGGTAAAATATGAAAGCGGAAGGGCGT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62