GenePrediction:GLEAN_755 Details

Name: GLEAN_755
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1891812..1905184 (+ strand)
Length: 13373
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1891812..1891859 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_97:1892036..1899821 (+ strand)
Length: 7786
Type: CDS
Source: GLEAN
Position: GCSC_97:1899893..1902016 (+ strand)
Length: 2124
Type: CDS
Source: GLEAN
Position: GCSC_97:1902194..1905028 (+ strand)
Length: 2835
Type: CDS
Source: GLEAN
Position: GCSC_97:1905090..1905184 (+ strand)
Length: 95
>GLEAN_755 class=GenePrediction position=GCSC_97:1891812..1905184 (+ strand)
ATGGTCAAGATATCAAAGAGCCTGCAGTCAAAGCACAAGGAGTCTATGGTGAGTTTTGCTCGCATCGGGGCCCACGGAAT
ACCCACGCCTGCCTCGCATTTCCCTGCCTGGCGGCATCGCCTATGAGATCACCCCTCCCACCGTCAAAGCCTTGCTCCTG
CTTCATCTCCACCCCCACCTGTTCGTTGCTGCTGGCCATTTGCTGACAATGCCCTCTTTCACAGTCTCCTTGGCTAGCTG
ATTATGTCCAGTCAGTCGCAAAGACCCCGCTTCCGCTGCTGCCCAGTGAGCTCGACAAGTTTCCGTCAAGATGGCCGTTC
CCGCGGGGCGATTTGTACCACTGGATTCCGCTCCTCAACAGGTTCGACAACATACTCGAGTGCTTCGTTCAAACATACGG
CCTCCAGGCCGGGCCCCAGATGCGCGACTTTGGATGCGAAATCCTCCTCCAGACTACCTCCCACCAGGTCGACTTCCGCG
ACACCCGAAAGTGGGACGCCGCTGAGCTTGCCCGGCTTGGCTTCGGACAAGATGGCGACAGCCAGCTGGTGTTGGCTATC
CTCAAGTTTACGCGTGGCCTCCTCCAGCACTGCGGAAACAGGAGCATCTATGCCAGCAGCGCCCATCTCAGCAGCCTCCT
CAACTCCGCATCCCTGCACATACTCAAGGCCGCCCTGCACGTTGGCCACGAGCTTGCACTGCGGTACCACGCCTCTTACA
AACGCGCCAGCACGACGTCCCGCGTCTTCCACACTGCGCTTCTCCAGAACCACTACGACATTGACCTCGATCGAGTCCAA
CAGCTGGCTCAGCCGTTCATCAAGACCCCTATCGCCGGCTCTTCCATACCGGCTGCGCCCGCCCATCCCTTTGCCTCCAC
GCCAGCATCCGCAAGCGCCAAGGGCAAGGAAAAGGCCGAAGGCGGACCGTCAGTTTTGGCGACTGCAACTGCCACAACGG
CGACGGCGACGGCGACGGTCTCAGCCGCGACTTCGCAGAACGTCACGACCATGTTCACGAATGACTTTGTTGCCATTGCA
ACTGAAGGCTCGACAGACCCAGACGACCAGAACGGGAACACTTCTCCCCAGTCGTGGAAGGTTTGGGGTGACGTCAAGGT
CACTTACTACCCAGAACACCATCCGCGCCAGCAAGAAATCACAGAGAATGACTCGCCACGAGGTCAACGCGGATTGGTTG
ACTCGTATGCGTCTGCACCCTCCACCCCTACACCACTGCGCCGCAGCTCTACCATGGGCAGCCAAGACCGGACTCCGCGG
GCGGAGCGCACGAGCGCCACATCCGGGGTAGCAAACTCTTGGTCAGTGCCGGACGAGGCTTCGTCTCCCTTCTCACCAGT
GCCGACTCGCTGGCCCGGAGGAGATGACGGCGCGGCTTCCGGTCAGCGTACCTTTGAGATTCCATACCATGCTGTACAGT
CCTGCTCTGTGTATGAGCTTATGGCCCGCTGTCCGACCGAGATGCCTGCACTGTCCCGCTACGAGGTGCTGAGCCGCATT
CGGACGGCCAGGGCTCTGCTTGACTCTGTGGAGCAGCGTCAGCTGGCTCTTGCTGTTCGTCTGCTTGCAATCACCAATTT
GGCGTTTATCCATCCCGAGATTGCCTTCCTTGAAAAGGTTTTGAAACAGGATTCGGAAGAACCGAGAAGATATCAACTTA
CTTACCAACTGGCCGAGCTCATCCGCCCTGGCGCGGGCAAATCTCCATTGCCTGTCTGGCTGCAAACCATAGCCCTCCAG
CTGCTGGAGAGCCTGGCTGGCTTCTCATCTAAGAATGCTGATGTCATGTCCGCGGTGAACGCGAGCGTCAATCATGGCGT
CTTGCTCTACGTCTTACGCAAGGCGGTGGCCGACATAAAGGAAGACAGGCCGGAGACGCCGGAAGAAGTGATCGAAAACG
ACGACTGGCGCAAGCAGCTATTCTCGCTGACGCTGCACCTCACTGCTGGCAACCGCATGCCCGAAATGATGACTACAGGA
CTCATGGAGATTTTGATCGATGCCTTGAATATACGCTCGAAAATCGCCGAACGCAACTACCTCGTTGTTGTCACCTTCCT
CGACACCGTGGTTTTGAGCTTCCCGACATCTTTCCAGCCGTTTGCAAACGCACATGGCCTAGACGTTATCTCAAAACTCT
TGGTGGACACAGCGGCCTCGGCCAAACGAATCGTTGAGAACGGCGACATCACGCCGACCAACATGCGTTGCAGCGTCATT
GACTATGACGTCCCCTTCTACCTCCAACAGACGCTGAAATGGCTGCTGAAATTCATCTATCACCTGATGGCAAGCTCATT
CCAGTTTGGACCTGGTACAGATCGTCTACTCCGGAATCTGGTTGACAATACGCAGCTCCTGCACAGCCTGCGCACGATCC
TGGAAAATATGACAGTGTACGGCTCTGTTGTGTGGACGAATGCTGCAACCGCTCTCAGCCACTTCATCAACCATGACCCG
ACCAGCTTCGTTGCCCTGTCCGAGTCGGGCCTGATTCAGAGCTTTCTTCAGGCCATCACTGGCCGGCCGTTGCCCACAGT
CAAGCCCGAAGCTCAGGACGCTGGCAACGACACCACAGGAGTCCCAGGTGATGATGCCAATGGCAGCGCTGAAACGAGCG
CTTCTGCTGCAGATGCTACAGCGACTACTGATGCCGCAGGGAACGCCGAAAATGCTGCTGCTGGAGGTAATCCAAGCCGG
GCAGCTGATGATGGCGGAAACGCGGATGATGATGACGACGGAACCGGGGATGATCCTGATCTAGATGTCCCAGTCGATAC
AGAGGACGCCTCTCTTGGCATCGTCAGTCGCGAGGGCCCACTGTCCGGCGAGGAGCTGGAGCGCCCCCGTGACCACAAGC
TGGCTGGAGGCATTTTGCCGTCCACTGAAGCCATTGGCGCCATTCCCTCCATCCTTAACTCGATATCGCTTAACAACTCG
GGGCGCAGAATGGTGGTGGATTCAGGGGCCTTTGAAAGCTACTTTGAAATCTTTGAGAACCCTGCTCACATCCGCTGCAT
GGAGAATGAGCCAGGATTGCCAGCCAACATCGGAAGCAACTTTGACGAGCTTGCACGCCATCACCCGTCGCTGCGAACAG
CTATCGCTAATGCCGTTCTGGTCATGGTGAGCCGAGTTCGTTATCTGGCTGACACGAAGGCGCGGACGGACGCCTGGGGA
GTGAAGCTTTCCCCGACGCCGCCGCAACGGTCGGTTGATGTCGTCAATGCTGCCGCAGCTTCAGAAGACACCGAGATGAC
AGACGCATCGGCAGCTGGCAACCCTACATCAGAAAGTGAAACATCGACCCCGACGACTCCAGCTTACCATGATGCCGGCC
CATACGTCAACGCAACGATGTTGTTTCTCAACGCTTACCAGAACAATGGGAGATTGCAAGCGTTGTTCATCCAAAAGGGC
GGAATTGAATTGGTCCTGGACCTTGTGGCATCTCCTGGCTTGCCTATCAATCAAAACCCACCCATGTTTGCGCGAAGCCT
GCAGCATTCCACCACACAGCTGTTCGATCAAAGTGCTGTTCTCGGCCTTCCGTCTTTGCTCTACCGGACATTGCACTCTT
TTGACGACCTTTCGCCACTGCTGAACAGCAATGTCGGCGGTGGTGATACCGGAAACATTGGGAAAGGCAAAGCTGTTGAC
ATCGGCAGCAGCAGCGAAAGTGAAAAGCCCAACCATGCATCCTACTTTGCATCTCTTATCAACCCTGCCGGTGAGACGCC
TACGGCTGACCAAGTGGCCGAAGGAACAGCCATGGTGAAGGCGCTTGCCAAGACCCAATCCCTGCTCAGCACGTTGCAGG
TCTGCTTCCCGTTGGCAAGACAGGGAACAACTTCCTTCTATAATGTCAACGTCTTTGATTATTACGAGGACCTGATCAAA
CGGCTGGGCCCCTTCCTTGTCTTCGTTATGAACGAAGAGGAAGCCATCTCTGCAGCAGTTCCCGACCGCTGGTCCCGAAA
GCCATCTACCTCACTAGATGCTCTGAACAGCCAAGACGGCTCTGGAGTCGCAGAACTCGACAAGCTGACGGAGGAAGAGC
ATGCATCTGATGCCTATCAAAACTACCAGCTGCTTCGGACGCTGCTGTCTTCTTTCACGCCCGTGATCGTCCAGATTCTT
CAGTCTATGGGCAAGGCTCTTCTGCCTCGCAGGGAGAGAGAACAGTTCCAGCGGTACCACCACCTGCGGGTTGCAGAGGC
GATCGCGGGGACCATCTTGGATCCATTAAAGGCGCTGGATGTGAGTGGACCAACGGGCCACAAGCACTGCAAGGTCTTAT
TGGGAGCCTTGTACGAAATCCTGGTTGATCACTCGCGGCACAGCGAACACGGAAACAGCAGTATGACCCACATTGTCGTG
CCAGTGCTTCTGGCAGTCAAGTCGCTCGGCGGTTTCGAGATTCTCAACACCATCCTTCGTAACTTTGCCCAAGAAATCGA
CCGGGACCAGCCCGAATCGGCACACAAGCTCTTGGAGGACCCAGCAAAGGAGCCGAACGACTCACCCAAGCTGTTTCTCG
CCGGCATTGGCATGAAGAGGATTCTGGACCTGTACAGCGTTCTCGTCTCCGGACAAAGCATCGAATCGGTAGGTCTGGTC
AGCATTTTCGGACGGACAGGAGACCGCCACTATTCGCAACAAGCCACCCACCAGCTGGTAATTGAGGTTCGCATGGCTAT
ATTACCGGCCGTGATGGATCTTTGGCAGTCGTCTGTCGCTGAGAAGATCTCAACAACCCTGCTTTCGAAGATTGTCGAGA
TTCTGAGGACTATTGCAGCCGGGCAGATGGAGGAAAGCAGCTTCACACGCGCGAACAAGCCCCGTGTGTCTCCTACGGCC
GTGTTCGGTGGCGACCTGGTCACCTTCAACTGGACGGTGACTAGGCTGCCGGAACTGCCGAAGATTCCCCAGGACCTGCT
TGACGAAGCGTGCTACCGTAGCAATAATGTTCCCGAGGCCTCGCTGGAGTATTGCAACGCACACCAAGCGGGACTTGCCG
GACCACGTCATCCAGTGCCCATTGAAGATACCGAAGCGCTTGTTAAGCGTCGGCGCGCAGAACTGGCACAGAGAAGTGCC
CCCCAGCCAGCAGCTGGATCGGCTGCGGCTTCGGTCACGTTGTCTGCTTCGGCGTCTGGTACTCCTGCTTCGGCTACTCC
GGCCTCCTCCACTCCGGCTGTGACTGCTGGACGCGCCCCAAGACTCCCCTTTCCTATGGACCCAATGGCACTTGACAGCA
GCCTTGGACTGGAAGACCTCTTCGAGTCTGTCGTCGGAGACGTGGGGCTTCGTGCTGTGGGAGACGCATCCGACCCCGAC
CATCCGTTGACTGCGACTCTGACGGCATTGCCCTCGCTCCCACCGCCGATTCTACCACCGTCTCCCCTTCGGCAGCAGCA
CAACGTGTCCGACGAGGCCGGTAACAACGGATCCTCTTCGCTCACGTCAGGCGCCAGGACTGAGGCCGCTTCTAGTACGG
GCCCCGACACGAATGCAACAGTCGTTGTGCCGTCGCCTGTCACTGACGCAAAGGGCGATACGCCGACTTCTAATGTTGTC
GTGCGAGAGGATCTGGAGGAACAGCGGACAAAGTTGAGAGAAGATCTGATAGACCGCTGCCTTGCGGTCATCCAGGTGCA
TCCGGATGCTGTGTACGAAATCTCGGAGCTGATCTCGACGAGCGTGTTGAAGCCAGCTGGAGTAGCCAATGGCGCACAGG
ACGTGGGCGAGACCCTGACAGAAGCACTCATGTCGTTCGCAATCGACGAGGAGAACAAAAAGACTCACGCGCAGAGCATT
GCGGCGTACGCACACCTTCTCTGTCTTCTCATTCGCGACGTTGACTCTTTCTTCCGCTCTACCGTTGACTCTCTGCGCCA
CAACATGGACGAGCTTCTTGGCTTCCTGAAAATCCCCTCTGGCAGTTCGTCCGAAGAGCTTCCGCCTTGGCTGCCGCACT
TCTATCTCCTCTTTGAGCTTCTCGCTACCGAGGATGAACAGCTGCCAACGTACAAATGGACGGTGCCTAGCCTGGACTCG
GAGAAGATGGGCGATCCAGAAGTCGAGGTCAAGACGCCAATTCTGAGCGACGCAAACTACAGCACTCTTCTCGAATCTGC
CCTGGATATCCTTCCGCGGGTTGGCAAAGACGAGGTACTGGCCGTCTCGGTCAGCCGACTCCTCGTCATCATGACGAGAC
GGCGCGAGGTGGCAAAGACTGTTGGCGACAAGAAGAATCTACAGAGACTGTTCCTCATGGCAAAGCAGCTGTCTGGCATG
GGGGCGAGCGGCTTCAAGGAGACTCGTATTGGCACCAATATTGTGACGATTCTCCGGCATATTGTCGAGGACGACGACGT
GCTCCGCCAAGTGATGCGCGCCGAGATCCGGCTTTTCTTCGAAACGTCACCACACCGAAATCTTCGGACGCATGACCTGA
AGGCATTCCTGCAATACCTAGGACATGTTGCCCTGCGGAATCCGAAAGTGTTCAGTTCCGTTGTCGAGGAGATGGTGCAG
ATCCACCGTTGGCCGCCTGGAGACAACCCGCTCAACTATGCCTTCACTGTTACCCGAAAACAGAGCAAGCTCGACAGCAG
CACCTTGGACATGGCAGCCACTAGTAGCCACGACGATTCACTCGGGCCAGCTGTCCAATTGACAGAAGATCTCAACATTA
ACGATGTCCGACCATCGACAGAAACGAACGGTGCATCCGGCAGCAACGGCGCAACACATGGCAGCAACACTGATAAGGAC
ATGCCAGATGCTCCCAAAGCTGAGCCGACTACGGAGCACAAGCGACCCATTGTTGAGAATCCAGACGGTGTTATCACCTT
CCTTCTAGAACAGTTGATGATCTACCAGAAGGTCGACGATGTTGAGCCCAACCAGGCGGCGAAGGATTCTGAAAAGACTC
CGTTGGGTACAGATATTCCACTAGCGTCTGCATCTTCCTCCTCGGCTGCTCCCGGCACCGAGGAAGGCGCAGCAGCATCG
TCTGGGGCCAAAGCCAGCGACAGCAGCAAGGGCAAGAGCAGCGGCGACAAGAAGGCATCCCGGGCATTCCAGTCTTCTGA
GCATCCGATTTTCGTGTTCCGAGGTTTCCTCGTGTTCTGCCTGACGGAGCTGCTTCACAGCTACACACGGACCAAGATGG
AGTTCATCAACTACAAGCGCGGCGTGGCCCTCCAGACGCACACGCCTGTGAAGCCTAGATCGAGCGTGCTGAACTACCTG
CTGCACGATGTCCTCTGCGGCGCTTACTCTGTCCCGAACGCGACGGTGGTACCAGAAGACACGATTGTAGCTAAGAAGAA
GCAGGCAATGGCTGATCAGGCACGGCGTCTGCTTGTTTCCCTGGTGGAGAAGACAAGCGAGCGGCCCATTGACCGGTCAC
ACAGCCGCTACGAGTTTGACGACGAGACTGATCTTCTGTTCGTGCGGCGCTTCGTCCTCGACACCGTTCTCAAGGCCTAC
AAGGAAGCCGCCGTCTCGACTGAGCCAATCGACGTTCGCTACGGCAAGATGACTGCGCTCGCCGAGCTGATGGCCGGCAT
GATTGGCGGTGACAAGGACCGTACGCTGGTCAACCACAGCCCGTTCTCGGAGACGGCCATCGCGCACTCTCAGATGCAGC
TGCGTCGTCTCATGTACGAGAAGGGCTTCCTGGCCGCCCTGACTGCGTCGATTGCCGACGTCGACCTGGCGTTCCCGGGC
GTGAAGCGTACTGTCAAGCAAATACTGCGCGTTCTGAACGTGCTCACCGGCACTGCTATCGAGCTGAGCCGCCTCAACAT
CCTGACTCATTCGTCATCGCCTGGTCCCGTCGAATACGATGCGATATCGACCTCATCCTTGTCCGATATGGAGGACGACC
GCGAAGAAACGCCAGATCTGTACCGCAACTCTTCTCTTGGCATGCTTGAAGGAGGAGAGCCTGACGAGTTCTCGGACTCG
GAAGATGGTGGTGAGCTTACAGCGTCTTCATTGGTCCCTTTTGCGCATCCTCTCGATTCGCTTTTGCTAACCCAGTCGTA
GATCAAGACATGTACGAAGGAGAAATGGACTACGAGGACGAAATGACGGACGAGGATGACGAGAACGTGAGCGACGAAGA
CGAAGACGAGATGGCTACAGTCGAACACCTCAACAACGAACACGGTGTTGTCGAACTTGTCATGGAAGACGGAGATGACC
ACGAGGGTCATGATGACGAGGACGACGATGAGGACGACGAAGACGAGGATGATGACGAGGACAGTGACGAAGTCGGCTCG
GAAGACATGGAGGGCCTCGAGGATCACATTGAGGCGATTGAGGAGCTCGAGGACGACGATGGAGCGTCGGGCTGGGAAAG
CGAGACGAGCGAAGACGACGATGAGGATGAGGATGAGGACGACGAGGACGACGATCACGACGACTATGACGCGGGTGCCG
GTGATTTGCACCAGGCCCAGATCCACCTGCCGGATGGCGATCCCAACGAGCAGCTTGAGGAATTGGCACGGTCTATGAAC
CCGACGTTTATGGAGGACGAGGATGGCGTCCGGTACGACGATCCGTATATCGAAGACGAGCTCGAAGAGGACGACGAGGA
CGAGGACGATGGGATGGAGGAGGAAGAGTACATCTACGAGCAAGGCTATCCAGACGAGGACGGCATGCAACAAGATGTAC
CTGCTGGCTTGACCTGGGACACGCTGGTGATTGAGCCGAACCACCATCACCACAACCATCACAACCATGTGATTGCACGC
CACCGTCACGGCGGCATGCGCAGCCCGTTCCCTCCCTTTGTCTTTGGATCTTCGCGCGACGGTGCGGCCGACTTTGGCAA
CATCTTCCGTTCCGACCGTACTGGCGCTGGAAGCGGCGCGGAAGAGGCTATCAACCCACTGCTCCGGCGCGCAGGCGGCT
CTCCGCGGGACAGCAGCCGGAACGGCCACTCTTCAGCTACATTCCGTATCGGCATGCCAACGGGCGGTGCATTCAGCGCG
CCGGAGAACCCGATCGCATTCCTCAACGACCTGATGGCATCTCTGCCCAACCTTGCCGGACGTGGACAGCCATTCCACTT
CCAGATCACGCACCAGGGTCTGCGCAACGAGTTCCGCGAGTTGACGTCGCCCAACCATCCGGACTCCCGTCTGGGCACGG
AGCTGCGGTCGGTTGAAGGCAGACGCGAATCGCCTGTTGAGCCGCACCAGGCAATTTCGTTCCGTGTGGCATCTACGGGC
GACCGCTGGGTACACGAGGCCAAGATGGTGTTCGGGCCTACCTTCAACGAGAAGGCAGAATCGTTGATGTTCCACCGGAT
CCTGTTCATTCTCGCGCCGGCGGCCATGGAAGAGGCTCGCAAGGAGAGGGCGCGCCTGGAGGTGGAGCGCCAGGAAAAGG
CGAAGAAGAAGCTTGAGGAGGAGGAGAGGAGGAAGCGCAAGGAGGAGGAGCGACGGCAGCGCGAGGAGGAAGAAGAGAAG
GAGAGGAAGGCACGCGAGAAAGAAGAGGCCGAAGAGCGCGAACGGGAGCAGGCTGAGCGCGATGCGGAGGCCGCTGCTGC
CGGTCAGACGGGCGAAGCAGCAGTGACGGGCGAAGCCGATGGCGCAGACGAAGCGGCCGGACGAGACACGTCGGAACCGA
TGGAGGGAGTGCAGGCTGACGGCGACCAGAGCCATGTGGAAGAACCGGCGACACGGGAGGAGCCGGAAGAAGAGGTGCCG
CAGCAGCGGATCATGACGACGATTCGTGGCGAGGAGATCGACGTGACAGGTCTCGGTATCGACGCAGAGTACCTGGCGGC
GCTCCCAGAAGAGTTCCGCGAGGAGGTGATTGCCAGTACGCTGACAGCACGGCGGTCGGAGGCACGGCAGCGGGCAGAGT
CGACGGGCGAGCAGATCGAGAACTTCAACGAGTTCCTGGACGCGCTGCCGGAGGATGTGCGGATGGAGATTGTGCAGCAG
GAGCGGCAGGAGCAGCGACGCCGACAGCGCGAAGACAACCGACGGCAGACAAGCGGACAGGACGAAGGCGGCGACAACAC
GGCACAGGAGATGGACACAGCCAGCATCTTGATGACGTTCCCGCTGGAGCTGCGGGAGCAGATCCTGATGGAGCAGGGCG
ACGAGCTGCACGACCTGCTGCCGCCGAATCTGCAACACCTGGCGCGTTCGCTGATCGAGCGGAACCGGCTGCCACCACAG
AGAGCACAGCGGCTGCGAGACGATGAGGCGGGACGGATGAGCGGCGAGGGCGGCTCTGGAGCGGCAGCGGCAGTAGCAGC
AGCAGCGGCAGCAGTAGCAGCAGCAGGCGGAGCTTCCGGGACGGCCGGAACTGGCGGCACAGCTGCGGGCGACGCGAGCG
CGGCGGTTGTCAAGGTGGAGCGACGACAGGTGGTGCAGATGATGGACAAGACAGGAGTGGCGACGTTGCTACGGCTGCTC
TTTGTGACGCAGCAAGGATCCGCACGCAACAGCCTCTTCAGCCTCTTCATGGACCTCTGCCAGAACCGACAGACGCGGCT
AGAGATTATCAGCACGCTGCTGCAGGTGCTGCAGGACGGCAGTTCGGACATGGACGCGGTCGAGCGGTGCTTCAGCCAGC
TGTCGGCCAAGGCTAGGATCCACGCGCGCGACAAGGAAGCAGCGGCCAAGATGATCGGGGCGTCGGGCTCGGGCGCGGCA
GTGACGACGACTCCGGGCACGGCACCCGGCAGCACGCGCAAGCGGCAGCAATCGGCGATGCTGCAGACGCGGCTGGAGAG
CTCGCCGCTGCTAATCATGCAGCAGTGCCTAGACTTGCTGGTGGAGCTGTGCAGCAAGAGCCTTCACATCCCGTCGCTCT
TCCTGACAGAGCACGACATTGCCGGGGCGTCGCTGCGGAAGCCTCCGAGCAGTCGCAAGGCCAAGGCGGTACAGTCGCGG
GCATCGCGATTCGGCATCAACCTGCTGCTGCTGTTGCTGGAGAAGGAGCTGGTGATGGAGAGCTCGTCGGTGATGCAGCT
GCTGGCGGACCTGCTGAACAAGGTGACAATGCCGCTGCAGGCGCTGGAGCGTCGGCGACGGGAGGTGGAGGCACAGAAGA
AGGCGGAGGAGAAGGCGGCAGAAAAGGCGGAAAAGGCACGGATAGAGCGGGAGAAGAAGGAGGAGGAAGAGGGCACAAAA
GCAGAAGAAGAGACGGGCGAAGGAACAGCTTCGCGATCGGCAGCTGCAGCGACGCTGGTGACGATTGCAGCAGGCGGGCC
GGAAGCAGACCAGAACAAGGCGCGAGAGCTGGAGCCGCCGTTGATTCCAGACAGCTATATGGCGCTGGTGGTCAACGTGT
TTGTGGCGCGGGAGTGCAGCTCCAAGACGTTTCAGAACACGATCTCGACGATCAAGAACCTGTCGTGCATCAGCGGGACG
AAGCAGCTGTTTGGGCAGGAGCTGACACGACAGGCCAAGGCTCTGAGCGAGAAGATCCTGGCAGACCTGGAGACACTGCT
GCCGCACATCGAGGCGGCCGAGACGGGGACGGAGATCCAGGGGATCGCGCTGGCCAAGTTCTCACCGGGAGCAGCGGAAC
AGAACAAGCTGCTGCGGGTGTTGACCGCGCTGGACCACCTGTTTGGGGTGCAGGCGAAGAAGCAGGAGGCGGCGGCGCTG
GGGGGCGACGAGGCGGGCAACGGGGCAGCAGTGGGCCCTGACAGCAACGACAGCAATGGCTCGGACGACTACATGGGCGA
GCTGTACCGCAACACGACCTTCTCGGCGATGTGGGGACGACTAAGCGCATGTCTGGCGGCGATCCGGCAGCGGGACAGCA
TGCTGAACGTGGCGACGATCTTGCTGCCACTGATCGAGTCGTTGATGGTGGTGTGCAAGAACGCGGGCGTGGGACAGAAT
GCGGGCAGCAGCAGCAGCGACGGGACGACGCCGGGCGACGAGGGCATGACGGTGGTGTCGGAGCTGTCGAGCCCAGGAGC
CCGAGCAGGCGACGAGAACGAGCCGGTGCGCGACCTCTTCTTTGAGTTTACGGAAGAGCACCGGCGCGTGCTCAACGAGC
TGGTGCGCAACAACCCGAAGCTGATGTCGGGCACGTTCTCGCTGCTGGTGCGCAATCCCAAGGTGCTCGAGTTCGACAAC
AAGCGCAACTACTTCAACCGCAGCGTGCACGCCAAAGCAGGCGGCCAGACACACTCGCGGCCGTCGTTCCCGGCGCTGCA
GCTGTCGGTGCGGCGAGACCAGGTGTTCCACGACTCGTTCCGGTCGCTCTACTTCAAGACGGGCGACGAGATGAAGTACG
GCAAGCTCAACATCCGCTTCTACGGCGAGGAGGGAGTGGATGCCGGCGGCGTGACGCGCGAGTGGTTCCAGGTGCTGGCA
CGCCAGATGTTCGACGCCAACTACGCCCTCTTCATCCCAGTCTCGTCGGACCGCACGACCTTCCACCCGAACAAGCTGAG
CGGGATCAACGACGAGCACCTAATGTTCTTCAAGTTCATCGGCCGCATCATCGGCAAGGCCCTGTACGAGGGCCGGCTGC
TGGAGTGCTACTTCAGCCGGGCTGTGTACAAGCGGATTCTAGGCAAGCCGGTCTCGGTCAAGGACATGGAGTCATTTGAC
CCGGAGTACTACAAGTCGCTCGTCTGGATGCTGGAGAACGACATCACGGACGTGATCACAGAGACCTTTTCGGTCGTCGA
CGACGAGTTTGGCGTGACCACGGTCAAGGACCTGATCGACGGAGGCCGCGACGTGGCCGTGACCGAGGACAACAAGCACG
ACTACGTCCGTCTGGTCGTCGAGCACAAGCTGTTGGTCTCGGTCAAGGACCAGATGGAGGACTTTCTCCGGGGCTTCCAC
GACATCATCCCGGCCGAGCTGATCTCCATCTTCACCGAGCAGGAGCTGGAGCTGCTCATCTCCGGCCTGCCCGACATTGA
CATTGACGACTGGCGCAGCCATACCGAGTACCACAACTACAATGCCGCCTCGCCGCAGATCCAGTGGTTCTGGCGTGCCG
TCCGCTCCTTTGACAAGGAGGAGCGCGCAAAGCTGCTGCAGTTTGTCACCGGCACGAGCAAGGTCCCGCTCAACGGCTTC
AAGGAGCTCGAGGGCATGAATGGCGTCAACCGCTTCAACATCCACCGCGACTACGGCAACAAGGACCGTCTGCCGAGCTC
GCATACGTGTTTCAATCGTGAGTTGCCCTTTGTCTCCGGCTTTTTGTGTATATTGCATAAGCTAATGGCACGGTACAGAA
CTCGATCTACCCGAATACGACAGCTACGAGATCATGCGGAGTCAGCTGATCAAGGCTATCACGGCGGGCAACGACTACTT
TGGCTTTGCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62