GenePrediction:GLEAN_7560 Details

Name: GLEAN_7560
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1297259..1296750 (- strand)
Length: 510
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1297259..1297257 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_140:1297159..1297115 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_140:1297058..1296750 (- strand)
Length: 309
>GLEAN_7560 class=GenePrediction position=GCSC_140:1297259..1296750 (- strand)
ATGGTGTGCTTTCCCTTCTTCTCTTTCCCTTCTCCTCTATATCTTATTCTCTCCGAGATCGTATCATCCCGGCCTCGGCT
GCTGACCGCTCTCCTCGCAGGTCTTCATTCTCGGCGTCAATTTCAACGAGCTGAAGCTGGTCAAGGTATGTGCAATCAAT
GGCCGTGCGCTGCCAGGCTGTCTTGCTCACAGTCCGTCTAGAAAGCACTCGAGTCCTTTTATGCCATTGGCCCCCAGACG
TCTGCCCGCATCCTCGCCAAATTCTCCATCCACCCACGAGCCAAGATGGGCACACTGCCGCCCAAGACGGTCACCGCGCT
AACGGCGGAGCTGTCCAACATGACCGTTGAGAACGACGCCCGCCGCGTCGTGCAAGACAACATCAAGCGCCTGCGCGACA
TGGGCACGTACCGCGGCAAGCGGCACGCCATGGGTCTTCCGGTGCGCGGCCAGCGCACGCGTACGCAGATCCTGACGGCC
CGGAAGCTGAACAAGCTGGAGCGGAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62