GenePrediction:GLEAN_7561 Details

Name: GLEAN_7561
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1293679..1290732 (- strand)
Length: 2948
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1293679..1293634 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_140:1293568..1293387 (- strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_140:1293334..1291894 (- strand)
Length: 1441
Type: CDS
Source: GLEAN
Position: GCSC_140:1291828..1290732 (- strand)
Length: 1097
>GLEAN_7561 class=GenePrediction position=GCSC_140:1293679..1290732 (- strand)
ATGCCTGGCTTCGCGGACTCGTTCTGGTCGAGCGACTATGCCGCTGGTAGGCCGACGGGATTGGGTGCATCTGGGGTTGG
CGAGCGATGTGCTGACAGCGTGTCCCCACAGGACTGGGCGTTCTGTTTGGCAAGCTCCAGCAGGGCGTCATCGAAGACCG
GCAGATTCTCACGATTGCTCGGATGCGCGCCGAGGCCGAAGAGGTGTACGGCCAGCGAATGAGCGAAATCCCCCCGGCGG
TCGACAAGATCCAGGGCGGCTTCTCGAATGACGATGGAGCCAGCACACGCAAGGTAGGTGTTGAGCGGCGGTGGTTGTTA
TTGTCGATGCTGACGTGACGTGCAGGCGTACGAGGGCGTGCGGACGGAGATGGAGGACGCGGCCCGCAACCACCGCAAGA
TCGCACAGAACATCCGCGACCTGGTGGTGAACCCGTTTGCGCGGTGGTGTGAGGCCCACGAAACGCGCATACAGGACAGC
CAGGACGAGCTGCAGACGCGGATCAAGACGCACGACAAGCAGGCGGAGCTGGTCAAGAAGCTGCGCAGCACATACTTTAA
CAAATCACGGCTGGTGGAGGACGTGGAGGAGGAAAACAAGCTGGCGTTCCAGGACCCAGAGACGAGCCCGAAAGCGAAGA
TCCCGGAGATCAAGGTGGAGAAGGAGGAGGAGGAGGCGGAGGTGCGGTACGAGATCGGCGATGAGACGTACCCGCCGGAG
GAGGTCAAGAAGATTCTGGTGCACATGCTGGACAACATCAAGCTGGGCGAGACCAAGGTGCCGATCCTGGGAACGTACAC
GAACACGTCGGCCGGATCGGACATTGTGGAGTACATGCATAAGCACATGGAGACGACGAGCGTGAGCTACGCGGAGCGGA
TCGGGCAGGACCTGGTGACGCACGGGTTTCTGCGGCTGGTGGGCAACGTGGGCAACACGTTTGCGAACAGCTCGAAGCTG
TTCTACCAGTGGCGGCCAAAGGCCTTCCAGATGGCGGGAGTGCCGGAGAAGAAGGCGGTGCTGGGCCGGACGTTCTCGTT
GCCGGCGGGGACAGAGTCGGAGAGCGGGTCGGTGGACTCGCCGGTGATGGGGACGGTGAGCGAGTACCTGGAGAAGTGGA
ACGTGCTGGGGATGGCGTACCCGAACGAGACATCGGCAGACCGGATGCGGCGGGAGGCGCGGGAGGCAGACGAGCGGTAC
AAGACGGGGGTACGCAAGCTGGACGAGCTGCGGTGCGAGCTGGAGGAGACCATTTTCAACCACCTGCGCTTCCTGGAGCG
TTGCGAGCTGGACCGACTCAAGGCAATCAAGACGGTGATTCTGGACTTCTCGGGGACGATCAGCAATGTGATCCCGAGCC
TGCAGTCGACGGTGGACAAGCTGGTGCTATTCCAGGAGACGGTGCAGCCGCTGGGCGACCTGCGGTATCTGTTGGAGAGC
TACCGGACGGGCAGCTTCATCCCGCGGGTGGTGACGTACGAGAACTACTACAACAAGGTGGACGAGGAGACGTTTGGGGT
GGACATTGAGGCACGGGCGCGGGCGGACAAGAAGCGGGTGCCGATTATTGTGACGTCGCTGCTGACGTACCTGGACCACC
ACTACCCGGACCTGGAGGGCGACGAGGCGCGGCGCAACGTGTGGTTGCTCGAGGTGCCGCTGCAGCAGACGCACCGGCTG
CGGGCCAAGGTGAACCACGGCAAGGCCTTCTCGCTGGAGGTGTTGCAGGAGTTTGACATCCCGACGGTGGCGAGCCTGTT
GAAGCTGTATCTGCGGGAACTGCCAGGTGAGATGAGAGATTCTGACAGGATGATGTGCTGTGTTGTGTTCGTCCGGCTAA
CCGACCGACAGACTCCCTCGTATCTTCGCATGTGTACGAGATCATCCGGACCATCTACCAGACGCCAACGGGCGAGGGCA
GCGACGAAGGGCAGCGGGTGCCGGTGCTGCAGCAGACGCTGTCGCAACTGCGGCTGACCAACATTGCGACGCTAGATGCG
TGCATGAACCACTTTACGCGGCTGATCGAGCTGACGTCGGCAGACGAGGCATACGTGGCAGCGCTGGCGACTGAGCTGGC
GCCATGCATCCTGCGGCCACGCATCGAGAGCTCGCTGACGATGGAAGAGAAGCACGGGTACCGGCTGGTGCGCGACCTGT
TTGCGCACAAGGGGGCCATTTTCAAGGAGCTGAAGCGGCTGTCGGCGCTGACGCACTCGTCGTCGGTAACGGGGCGGCAG
AGCGCGGTGGTGAGCGGCGGAGGCTACGGCGGAGGTGGAGGTGGCTACGGTGGTGGAGGTTCGGGAGCAGGTGGCCTGGG
CGGTCCTGGGACTCCGGGCAGCGTGGTGAACCGGCCGCGAGCCATCAGCACGGACGAGAGCAACCGCAAGGCCAACATGG
AGGAGCGGACGCGGGCATTGCTGGAGAAGGCATCAGGAGGACGAGGCCGAGCCACATCGCCGGCGTCGGGACCACGGACG
AACCACCGGCGCGACAAGAGCAGCGGCGGACCCGAGACGAGGTTCCCGATCCAGACGAGCAGTCCGACAACATCGACGGG
CGGACATGTGCGCCAGAGCGTGGGGCCGGTGCTGGGAGTCAAGCGGCAGAGTCTGGAGGTGCCGGGCGAAGGAGGCGGCA
GCGGCAGCGACGGCGTGGCGACACCACCCAACGGCGTGGAACTGGTCGACGGAAGTGGTCCGGGGACACCGGGATCGCCG
GCCGAGAAGCGCAACAGCCTTGGTCGCACCAGCGTGCGGTTTGTGGGCGGCCGGCGGATTGCGCCCGTGGTGCCGACCCC
TTCGGCTACAGCGGCAGCAGCGGCAGCAGCGGCGGCAGCGGCAGCGGCACAGGCATCGGCGGCAGCTTCGAGTGCTGCGG
CGACGACATCGCCGACGGCCGGAGATCACCATGGTGTCACGCTCGTGGATCGACCGATGGACGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62