GenePrediction:GLEAN_7562 Details

Name: GLEAN_7562
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1286304..1284005 (- strand)
Length: 2300
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1286304..1284167 (- strand)
Length: 2138
Type: CDS
Source: GLEAN
Position: GCSC_140:1284119..1284005 (- strand)
Length: 115
>GLEAN_7562 class=GenePrediction position=GCSC_140:1286304..1284005 (- strand)
ATGGCGCGCATAGCGAAGAGGAGACCGGCCAGCAAGGCCGATACCTCTATCCGTGGCAATGGAGTCGTGTTGACGCCGCG
GAAACGACGGCTTTCCGAGATTGTTGAATCGCAGACAGAGGATGACGAGGATGAAGCCGAGGATCTGGATCCCATGACAC
CGACAAAGAGACAGCGCACGGTCGGACAGCAGCCTCTCTTGTCCGGATCGTGTACGAAGCAAAACCAGCAGCGGCAGCGA
CTGGCCGACGGCGAGAAAGACAAGGGTGCAGATCCCTACGACTACGACAGCGTCTACGATGTGCCGGCCGACGACAAGAG
CCTTCCGGTGGCGCCGAAGCCGAACAGCCAGCAGAAGCAGGTACGGCTGCCGAAGAAGCAGATAGCCGAGGACGTGGGCG
GCGGCGGCCAAGTCAGCACACCGACGGCCAGACGGCGAACGACGGCGATGTTTGGGACGCCGACCAATGCCTTTTCCGTG
ACGACACCACGAAAGGCAATTGTCGACACGCCGATGCGGCGGTCCATGGCAGACCGGTCGGCGCGTCGGAAGAGCACGCG
GGCACTGATCGACCGGGCTGTGGCTGGAGACGAAGACGAGGATGATGATGACGAGCTAGAGGCCAGGATATTCGGGGTGG
AGGAGGACGAGGACGAGGACGAGGACGAGAACGTGGTAGGGGATGAAGAGGAAGATGGCAAGACGGACGAGAAGATTGAT
CAGACCGACAAGACAGACGTCAGCGAACAGCCGATGGAGCCGGTGACGCCGAGACGGCGTGGCAGGCCGCCCAAGGTCAA
GAAGGATGAGACAGCAGCAGCAGCAACAGCAACAGGAGAAGGAGAGCCGTCACCAGTCAAGCGTCGCGGCCCAGGACGGC
CTCGCAAAGACCAGACGGCCACGGGGACTAGCAGCAGTCGTCGCGGACCGGCAACACCACCGCGCGACTTGCCGGCCCAC
GAGCACTTTTTCTTCCAAAACAACCGGACCGGAGCAGCCAAGACGTCCAACAACACGCTGGCCGGGTTGACGCTGCTCAC
ACACGAGGAATACTTTCAGCTCGGCGAGGCCAGCAGCAACAACAGCAGAGCCAACCACGAGACCGAGGTGCGCTTCCTCG
AGGACCTGCACGCGCAGTCGTTTGGGCAGTGGGCCTTTGAGCTAGCGCAGGGCTTCGGCGTCTGTCTATACGGCTACGGA
TCGAAGCGACGGGTGCTGCGGGCGTTTGCTCGAGCGCTCTATCAGGGTGGTGGTAGTGGTGCCAACCGGATCGTCATCGT
GGACGGCTGGGCTGCCGGAGGGGGGATGGGGGGGGGACGAGGCACATCGACAGCGGCAGCGTCAGTATCAGCGTCAGCAG
CAGCGCTGCGAGACATTATGGGAGCCGTGGCAGCAGCAGCAGTGAGTGGAGGGAGTGGTGAAGGTGGTGGTGGGAGTGAA
GAAGAGGGCGACAGTCATGGTATCCCTCATCTGCCAGCCATCATTCCGGCGGCTGAGCGGGCGCTGCTGGCGCTTCTGGA
TGCTGGTCTCGACACGACGTCGACGCCGACTGTCACGCTCATCATCAACGGCATCGACGCGCCGGCTCTACGACGACCGG
CCGCTCAAGCGACGTTGGCTCGCGTGGCTGCTCATCGACGCGTGCGGCTGCTCTGTGCTGCCGACACGCCCGGCTTTGCG
CTCTTGTGGGACGGCGCAGCGCGGGCGGCCCTCAACCTGGTCTTCCACGACACCACCACGTTTCGTGGGCTCGTGGGCCA
CGGCAGCGACGAGCACGAGGCAGATAGCGGTCTCGATGCCGTCGACGAGGTGCATGCACTGCTGGGCCGCCGCGTGCGGC
GTGTTGGCGGCAAGGACGGCGCGGCGTTTGTGCTGCGCAGTCTGCCGGAGAATGCGCGGAGCCTGTTCCAGCTGCTCGTG
GCGGAAGCGCTGGCCGGAGGTGGTGGAGGAGGAAGACGAGGGGGGAGAGACGGCCGGAGAGCCGTGTCCGACGACGACGA
CGACGACGACGACAACGATGACAACGAGTACGGCGACGAGGGCGAGTCGGCCGGGCTCGAGTATCGCATACTGTACAACA
AGGCGGTGGAGGAGTTTATCTGCAGCTCCGAGATGGCCTTCCGGACGCTGCTGAAAGAGTGAGTTGGAAATGTCTTTGCT
GGGTTGACATATGCTGACTAATCAGATTCCATGACCACCAAATGGTTACGAGCCGCAAAGACGCCTTTGGCACCGAGCTG
CTGAGCCTGCCGTTTCGACGTGACGAGCTGGAGGCCCTGCTGGAGGATCTAGTATCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62