GenePrediction:GLEAN_7569 Details

Name: GLEAN_7569
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1247932..1246897 (- strand)
Length: 1036
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1247932..1247916 (- strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_140:1247840..1247721 (- strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_140:1247411..1247353 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_140:1247277..1247167 (- strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_140:1247096..1246897 (- strand)
Length: 200
>GLEAN_7569 class=GenePrediction position=GCSC_140:1247932..1246897 (- strand)
ATGAACGCCCCGGACAGGTGAGTGAGGCTGGACTGAAGTGGTTTGCCACCCTGCCTCTGAAGCACTGAGAGCGCCAGAAT
TGAAGATGACAGCGTTGCCGTCATGGCGGCCTGCTTTTGTGAACTCGGCCCGATCGCAGTGATGCAGGCAGCCGGTCAAG
TGACGCCGGCTGGTGACGGCGCCTCTGCGGACAAACTGGAAAGACGCGATGGGTGTGTCGAGGGAAGGCGCGCAGTACGC
TCCTTCCTCTACAAGCCTGCCAAACACGCGCATCCCCATTCGCGTGTGTCTCGTCGCGTTCCGCCATCTTTTTGGCCGAA
GGCAATGGCTATGTCCCATCTGCATCATTCCTACTTGACGACAGTATATGATCCCCTTCCCAAAAGAGAGAAAAGAAGCA
TGGCGAACAACCGCCATAAGAACGTGCAGCAGAGGTTGGGCGGCTCTGGCGGGAGGAAACAGTGCCCTATTGTGGTTGGT
TTTTCTTGCGTTGCTGACAAAGGTTCAAATCTACCCCGTAGATTCGAGCTGTTCATTCTCGGTGATGGCGAGAAGAAGAT
CACCGAGACGCCGTTCACCGGTAAGGCCACAGCTTCCTGTCCAAGCCAGAAGCGTATGGGCACGGGGTACATTCAGGACT
GACCACCGACCGTAGGAATGGCCAACACATCGGATTTCCTAATGTTGAAAGAGGACCATACATTGGGAAACCTCCTGGCC
GAGCACTTGAAGATGCATCCCAAGATTCTGATGGCTGGATACAAGGGTAGGTATTTGCCCTGACCTGTTGCAGACGTTTA
TCTCTTTGCCACCCCGGCTGACACCTGCCGTCACAGTGGCCCACCCTAATGTGGCCGAGGTTCTGCTCCGTGTCCAGACG
GACGGTACGGTGACACCCAAGGAAGTGTTGGTGGAGGTGTGCAAACAGCTGGTGGCAACGCTGGGACATTTGAGTCGGGA
GTTTACGCGCGAGTATGAGTTGCGGCGTATGGCGACGGCTGGCGAGCAGCAGCAACAGCAGCAGGGCGGTTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62