GenePrediction:GLEAN_7571 Details

Name: GLEAN_7571
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1241019..1239249 (- strand)
Length: 1771
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1241019..1240976 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_140:1240926..1240617 (- strand)
Length: 310
Type: CDS
Source: GLEAN
Position: GCSC_140:1240555..1239535 (- strand)
Length: 1021
Type: CDS
Source: GLEAN
Position: GCSC_140:1239472..1239249 (- strand)
Length: 224
>GLEAN_7571 class=GenePrediction position=GCSC_140:1241019..1239249 (- strand)
ATGGTCACCCTGGAAGAAGCCAACCGCCTGCTGTCGAAGCCGTTGTACGTACAGCTGAGTTTCTGTTCTTTTCTGTTCTA
ACACAACACACAGCGACGACAGCAATGATCTGCCCGATCGCTCCCAGTCGGCCTACCGGTCGCTACAACGGTTCCGCCTC
GCGTCCGACCGCCCGTACCAGCAGCAGTTTGGCGACATGTACTTTCTGCGGCTGGCCAAGATCAAGCCGGCGGTCGAGAA
GGTGGCGGTCGAGGCTTTTGGCGATGTCATCGTGGCCGGCGAGCCGCCAAAGCAGGTCGACCGCGTGCTTGATGTGCGCC
AGGGCGAGTTCTGCTGGGTTGCCGGGACGGTCTACATGGACATGCCGTTCAAGCCTAGCATTTTAGATGATGTGTCGAAG
GACGTGAGTTTTTATATTTTTCCTGTATTCTTTTCTCTCTCCTTGCTCACATCTGACGGCCCAGAGGCTTCTATCACTCC
CACCCGATGTCAAAAAGTATATACCCGAGGACGGTGACGATGACCTGCTGGCCGAGGGCCGTGGCAGCGTCTCCGTCATG
CTGGAGGACGAGTCGGGCCGCATCCGGCTGGTGGGCAAGGCGTTGCGTTCCGTGCTGCTGGTCACGGGCTGTATCGCTGC
TGTCATGGGCACGGAGAACGAGAACGGCGAGCTGGAGGTGCTGGACATTGTGTTTCCCGACCTGCCGCCCCAGCCGGCCC
GCTGGGAGCTCTCGGGACCACCGACGGGCGACGAAGCCGAGAAGCAGCCGCCTACAAAGCGAGTCAAGGTCGAGGAGGAG
GACGATGATGACGATTTGGACATGGACGACGACGGACACACAGACCACAAGCAGACACAGCGCAGCAGCAGCAGCAGCGG
CAACAAGATTGCCATCGTGTCGGGCCTGCGTTTTTCGGGACCCCATGGTGCAGCTGCGGTCGAGACAGCCCTGCTGCTAG
AGTATCTCCTAGGCGAGGCGTTGTCACCAGCATCACAGCGTGCGGCTGCACGCATTAGCCGGTTGATCGTGGCGGGCAAC
TCGATCGTGGCGGCGCCAGTGGCAGCAGCGGCCGGCGAGCGGCAGCCGACGAAAAAGTACGGCTACGACAGCAGCACCTA
CGACCCAGTGCCGAGCGCGATGTTGGACGAGTTTCTGGCCCAGCTGCTGCCATCGATGCCGGTAACACTGATGCCCGGTC
CCGACGACCCGTCCAACGCGAGCATCCCGCAGCAGCCCGTGCACGCGGCCATGTTTCCGCAGGCGCGTGCCTTTTCGACC
GCCAACGAGACGGCGGCCGAACCGGGCTCGCTGGATGCGGTGACGAACCCGTGGGAGGGCGAGGTGGCCGGCTGGCGCAT
CCTCGGGACCAGCGGCCAGACCCTGGACGACATGCAGCGATACGTGCAGAGCAGCGACCGGCTGGGCATGATGGAGGCCA
CGTGCCGGTGGCGCTGCTGTGCACCGACAGCTCCAGACACGTTGTGTGAGTTGTCGCTGTTCTTCTCTCCTGTCCGTTTC
TGACTGCTCTTCTGCTAACGCGCCCAGGGAGCTATCCGTTCCAGGAGGACGATCCGTTTGTCATGGACGCCTGCCCACAC
GTGTACTTTGCGGGCTCGCAGCCCGAGTTTGGTACGCGGCTGATCTCAGGTCCTGATGGCCAGGAGGTGCGGCTCGTGGC
TGTGCCGTCCTTTAGCGAGTCGCCTGAGATTGCGCTAGTGGACACGGACACGCTGGAGGTCACGCGGGTCAAGATTGGAC
GGTCAGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62