GenePrediction:GLEAN_7572 Details

Name: GLEAN_7572
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1238213..1235335 (- strand)
Length: 2879
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1238213..1237576 (- strand)
Length: 638
Type: CDS
Source: GLEAN
Position: GCSC_140:1237330..1237268 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_140:1237159..1235335 (- strand)
Length: 1825
>GLEAN_7572 class=GenePrediction position=GCSC_140:1238213..1235335 (- strand)
ATGCACGCCAGCAGCAGCCTGCTCGTGGCGGCCGTTGCGGCCTGGGCACCGGCAACGGTCACGGCCGCGGCGCTTCACGG
AAAACGGGACGCAGTGCCGGCGGGCTTTGTGGCGGCTCCGTACTATCCGGCGCCGCATGGCGGCTGGACAGCCGACGCAG
ACTGGACGGCCAGCTACGCCAAAGCACAAGCGCTGGTGGCACAGATGACGCTGGCCGAGAAGGCCAACATCACGTCTGGC
TCGGGCTTCTACATGGGGCCCTGCGTCGGCAACACCGGCAGCGCTCCGCGGCTCGGCTTCCCGCAGATCTGTCTGCAGGA
CAGCGCTCTCGGTGTGCGCAGCACCGACAATGTCACCGCCTTTCCGGCCGGCATCACGACGGCCGCCACCTGGGACAAGG
ACCTGATGCTTGCCCGCGGTCGCGCCCTCGGCCAGGAGTTCCGCGGCAAAGGCGCCGGCGTCTATCTGGGCCCGACCATC
GGACCGCTCGGCCGCAAGCCCAAGGGCGGCCGCAGCTGGGAGTCCTTTGGCGCCGACCCCGTGCTCCAGGCCATCGCTGG
CGGCCTCACCGTCCAGGGCGTGCAGTCGCAGGGCGTCATCGCCACGGCCAAGCATCTCATCGGCTATGAGCAGGAGATGT
ACCGCATGGACAATGTCGTCATGCCGGGCTACAGCGCCAACATTGGTAAGTTTTGTTGTGTTTTGTGTTTTTGCTTTGTT
CTGTTTTTGGCCTCTTTCTCTTGGTCTTATTCTTACCAAAATCAGACGACCGCACGTTGCATGAACTCTACCTCTGGCCG
TTTGCCGAGACCGTCCGCTCTGGCGTCGGCTCCATCATGGCTGCGTACAATCATGTCAACGGATCTGCCTGCTCGCAGAA
CAGCTACCTGATCAACGGCCTGCTGAAGGACGAATTGGGCTTCCAAGGATTTGTCATGTCCGACTGGTACGTTCCTTCCC
GTTCCAAGCTTCGTTCCTTCCCTATTGTTGCTCGCCATATCCCATCCTCTCATCCACCTCATCTCAAACATGGCCAATTT
CTCACACCTCTCAGGCTTGCTCAGGTATCCGGCGTGCCGTCCGCTTTGGCCGGCCTCGACATGGCCATGCCCGGCGACAC
CATGATCCCGCTGCTGGGTACCAGCTACTGGATGTACGAGATGTCGCGCGCCGCCCTCAACGGCTCCTTGCCCATGGACC
GTATCAACGACATGGCCACGCGCATCGTTGCCACCTGGTACCAGATGGGCCAGGACGACAGCTTTCCGGAACCCAACTTC
TCCTCCAACACGGCCGACGCCACCGGCCTGCTGTACCCGGGCTCGGTCTTCTCGCCCAGCGGCATCGTCAACCAGTACGT
CGACGTGCAGGCTGACCACGCCACTGTGGCCCGCCAGGTGGCCACGGATGCCATCACGATGCTCAAGAACGATGGCGGTC
TGCTGCCGCTGGCACTGTCGCGGCCGTTGGCCGTCTTCGGCACCGACGCTGCTGTCAACTCTGCCGGCGCCAACGCCTGC
ACCGACCGCGACTGCAACACCGGCACACTCGGCATGGGCTGGGGCTCTGGAACGGTCAACTACCCCTACTTTGACGATCC
CATCACGGCCCTGCGCAACCGCACCGCCGCCAACGTGACCTTTTACAACACCGACAGCTTCCCGTCGGCCGCCAAGAACC
CTGGCCCCAACGACGTCGCTGTCGTCTTCCTCAGCTCCGACGCCGGCGAGAACTCCTACACGGTCGAGGGCAACCATGGC
GATCGCGACAGCTCTGGCCTGGCTGCCTGGCACAATGGCGATGCCCTCGTCAAGGCCGTCGCTGCCGTCTACAGCCACGT
CGTCGTCGTCGCCCACACTGTCGGCCCGCTCGTGCTCGAGCCCTGGATCGACCTGCCCGCCGTCAAGTCGGTGCTCTTCG
CCCATCTGCCCGGCCAGGAAGCCGGTGCCTCGCTCGCCGACATCCTCTACGGCGTCGTCTCGCCCAGTGGCCACCTGCCC
TACTCCATCACTTACGCCGAGGACGACTACCCGTCCAGCCTGACTAAGCTCACTGGCTTCGCCCTTGGCCAGCCTCAGGA
CACCTTCTCCGAGGGTCTCTACATCGACTACCGCTACCTCCAGAAGAACAACATCTCCGCTCGCTACGCCTTCGGCCACG
GCCTCAGCTATGCCAACTTCACTCTGTCGGCTGCCAGCATCGCCGTCGGCACTGCCCTGACTACCGTGCTGCCCGCCTCT
CGGCCGGCCAAAGGCACCACGCCCTCTTATAGCACCTCCATCCCTGCCGCTTCCGAGGCCGTCACGCCGTCGGGCTTCTC
AACCATCTGGCGCTACCTATACCCGTGGCTGAACTCGTCCGAAGCTACCGCCGCCGCTGCTGTCGGCGTCAAGGCTGCCG
CTGGAACGGCCTCGGCCATCTACCCCTACCCGGCTGGCTACTCCAACAACCAGACGGCCGGCCCGGCTTCAGGAGGTGCC
CAGGGAGGCAACCCGGCCCTGTTTGACGTCGCCTTCTCGCTCTCAGTCAAGGTCACCAACGACAACGTCTCCTCAGCGCT
GTCTGGCCGTGCTGTCGTCCAGGCCTACATCCAGTTTCCCGCCAACAGCGTCTACGACACCCCCGTCGTCCAGCTGCGTG
ATTTTGCCAAGACGGCCTCGCTGGCCCCCGGCGCCTCGTCAACGCTGGAGCTGCAGCTCACGCGCAAGGACCTTAGCGTG
TGGGATGTCACCCAGCAGAATTGGGTCCTGGCCGGCCTGCCCAACAGCGGCAGCAGTCCCGCGCGCTACACCATCTGGCT
GGGCGAGGCCAGCGACAAGCTGTACACGGCCTGCTACACCGACACGCTCGAGTGCGTGAGCGGGTTGAGCGGGCCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62