GenePrediction:GLEAN_7573 Details

Name: GLEAN_7573
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1231918..1227429 (- strand)
Length: 4490
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1231918..1231472 (- strand)
Length: 447
Type: CDS
Source: GLEAN
Position: GCSC_140:1231212..1230832 (- strand)
Length: 381
Type: CDS
Source: GLEAN
Position: GCSC_140:1230751..1230513 (- strand)
Length: 239
Type: CDS
Source: GLEAN
Position: GCSC_140:1230036..1229229 (- strand)
Length: 808
Type: CDS
Source: GLEAN
Position: GCSC_140:1229171..1228302 (- strand)
Length: 870
Type: CDS
Source: GLEAN
Position: GCSC_140:1228217..1227429 (- strand)
Length: 789
>GLEAN_7573 class=GenePrediction position=GCSC_140:1231918..1227429 (- strand)
ATGGACGCGGCGTCGGCCATCATTGGCATTTTTGACTTTTCGCTCAAAATCGGCAAGTTGGTGATAAACTATGGAAAGTC
TATAAAAAACATGAACAAGACGATTCAAGAAATATCAAAGACAACGGCAGAGATCGAAAAGTGGCTACACGACGTTGTAG
GGGAGCACGAAGAACGGTTGAATGCTTATCTGGAAACCTCGAGCGCTTTGCGATCGGCGCTTTCGAAAGGTGGCGATTTG
GTAAAGTACAGAGATACTATGGAGCTGATGTTAGAAGATATGTTAAAGTATAGTCCCCTTTCCCTTGAAGAGAAGGGCGA
TTTCAAGCGGCGTATGCGAGTGATGGGCAAGAGAGGCATAGCCAAGGGAAAGTGGCCTTCGGTAGAAAAGAAATTACGAG
GGCTCGAAAGTGAGCTCAAGGAGCTCTTTGGGAGGATAAAAAGCGCAGTATCTATAAAAGACCAGTATGGCATCCCGTCT
CCTGTCTTCCTTTATTTGTATGGCCCGCTGTAACAGGTCTCTTTGCAGTCTTCTCATCGAGGCTCTGACTGCCGCGAGCA
AAGAGTTGATCCACACTCGGATTGTCACTTGGCTACGATTTAGAAAGCACGCCGACTCTTTTGACGACCATATGGAAAGG
CGAGTTAAAAGCACAAGTCGCTGGATACTGAACTCAGATGATAACAACAGATGGTTCGATCTCTAGTCGTCTGACACGAC
GCTCTGTTTCTGTGGCCTACCCGGGGCGGGCAAGACGTTTATCGCGACAGCCATCATCGACGACTTATCCCACAAGATTG
AGGCCATAGGCAATGGTAACGCTAAGACAGGCTTGGCGTTCCTGTACTTCAGCTCCGATATCAGCAAGGAGAACCAGTCA
GCCAGACGGCTACTCGGCCACATTCTGAGGCAGCTGATGCTCAACTTACCAGACGACGGAAACGAGAACAGCCCCTACCC
CCTAGTGAAGGCCCTCTACGACCGAAATATGCGGTCGAACTTGAGTGTTAAATCATCGATGCCAGAAACCTCAGATCTGA
TCGAAAAACTGGAGAACGTCATCGACTGGTATGACAGGGTGTATCTTGTCATTGATGCCCTCGACCAGTGCGTAGAACGC
AAAATCTTGATCGATTTCATGGATGTTTCCATGGCTTGCAAACCAAGAACGACCGCGAACACTACAAGATCAAGATCTTG
ACCACATCGACCCCAACGTTTGCACAATCAAAATTGGTTTGCATCGACGACACAAAGCAGCTGTCGCTGGAAATCCGGGC
AAACGACGAAGATATTAAGATCTACGCTGAATCTATGATTCCAGCTCTGAAATCGAGCCTGGTCAAGTGTGACGCCGGGG
ACGTCCATAAATTCATTGAAGTTGTGACCAGGGAGGCAAATGGCCTGTATGTTTTCCTCTCGCACCGCTCGGAAGTCTGC
TGACGACATATCATCTTTGCTAGATTCCTCCTTGCTGCATTGTATATGAACCTTCTCATAAGCCAGCCGGGCTATCCGCT
ATCTACGATACTTGCTTCCTTCCAGAATGGACCATCCCAACAAAGACCCTCTAGTCTGGCCATTGCTCACGAAATCTGCA
ATACGGCCTATGAAGCCCTTTTCGAGCGAATCAATAACAGAGATGTGAGCAGTCGGAGCCTGGCCAAGAAAGCTCTGACG
TGGGCTGCTTGTGCGACTCGGACGCTGTCTGTCACAGAACTGCTGTGTGCGGTCTGGGATGACGAGAATGAAGATATGGC
GAGAGAACTACGAGATATACGAAAAAATAAGCTCATGGACATCTGCTGTGGGCTTCTCGTCATACACGAGGCGAGAGACA
GCGTCAGTCTTATGCACGTCACGCTGAAACCTATCTGGAGAGCGGCAGCAGCAAATGGGCACCGCTTCCGTACCGCGAGA
TGGCCAGATACTGCATTGATCAGCTCTGCCTGCCCGACCTCTCATCGGGTCCTTTGCCTGGGGTCACGTGGTATCGTCTT
GGGCCGCTCGAGAGGCTGCTGCAGGACCGGCCTCTTCTGCGCTATGTGTCGTCGAATTGGGTGCATCATGTCTCTACGGG
TGTATGGGAGAAGTTCGAGAGGGCGGAGGACGCCAGAAAGTGGCTGGAGGCACGACTGAAGGAGACTCTCGTCGACAATG
CCAACAACGTGCTTTCGGCCTTCCAGGTGCTCCTAGTCAAGGCGCGAAATCCGTTTCCAGCAGGCGTCGCCGTCATGCAC
AACGTCTGCTACGTTGGCGAGCCGGAGTTTCTGGCCGTACTTCGACGGAGCAACAGGCAGGACCACGACAGAGCGTGTGA
CGAAGATGGAAAGACGGCACTACACTGGGCGATCCTTTGCCAGGATAGCAAGAAGGCCGCAGACATGGTGAAGGTGCTCC
TAAAGGACTTTGTAGGAAATATAAATGCGACCGACGCGGACGGCCGCACGCCGCTACACTATGCGGCCCTGGTCGGAGAG
ACCGAGACCACCAAACCACTTCTGGTCCACGGCGCCAAGGCCGAGGTCGGAAAGCGACGACAACAGATCACGCCTCGGAT
GACGGCCTGCTTTTGTGGACTCGACAAGGTGGTGGTTGAGCTGCTGATTAACAATGCCAATGTGAATGCGCAGAGCGAAC
AGATGGGTACGCCCTTGAAAGCCGCCTTCATGGCTGCATCGGAGGAGTGCGTGGCCGCCATCCTGTAATCGGGTCCACGC
CTGAAGAAGTACCGCGGCGACAAGCAGTCTGACGGGGCTCTGCAGCAGGCCGCTACCGGCACGTCGGCACCCATCGTCAA
GCTGTTGCTGGACGCTGGCTTTAACGCGAATTGTCTAGCAGGAACTCCGGCCGTGACTCCGCTTCAGGGGGTGGTGGCAG
TCAGTCATCCATGGCTGCAGCCGGGCAGTAATGTGGACATTGTCCGGCTGCTCCTGGATCACGGGGAAAAGACGACTGCG
AGGTTCCCTGACGGTAGCACTATCCTGGACGTGGCCGTCAGTAACGGATATGGTGACGTGGCCCAGCTGCTGCGAGAACG
GGGCGCAACCAACAGCAGAGGCTGGGGACTAGGAAGCCGCAGGCTGTCCAGTACTGCCTCGATGCAGGCAGCGGCGGCAG
TCGACTTACACGAGGCCGAAAGCGGGTATGCTGGAGGAGTGATGAGATCTATGCTAGACAGCCAGCTGCAGCTGTTCGTG
GCAGCTGTCACAATGGGCCATGACAGCATGATGGAAGAGTACCTGGTCATGGTTCTGACAGCTTTTAAATGGACTATCCA
GAAGAGGCAGGGGCCGTCTTTGCGGGCGTTATGCGATGTATCTGTAACGGCTTTCAAAAAAGTTGTCGAGCTCGCGCGGA
ACGACCAGGACGGTAGTGACGAGAACGGGGATGATCAACCATTATCATCGGCTGCTAATACCCCAGCGCATAGTCAGCGT
CTGCAGATGCTGGTCAGGCCAGCTTTGGCTGGGGCAACCGCAGTGCTTTCCTTGCTTACCGGATGGGAGACGCCCAGCGC
AGAAGAGATGAATGACAGAAACCGACAAGCCGCGAGCAGTGCCAGTGGCAAGCTGGAGAGGGTCACGCAGACAGCAGTGG
AGATCCTTCTCATGGCAGTAGACTTCGGTGATAGGACGATAGTCTGGCTGGTCGCGGATCATTAAGTAAAGGCGCTGCAG
TATATTTCCTTTTCTGGTCAGGCCAGCGATCCCATGATGGAGGTCCTGGTCAAATGCCTGGTGAAGGACTTTGAGGACTT
GTTCAAGGCTAGCGATCTGATCAAAGCCAAGAAGCAGGCTATCATCGGCATCGAGCTGCTGGCATCAGCCACCAGACAGC
GCTATACGCAACTGGCCTATAACCTAGCCGCCATCTGGGCGTTGGCCGCGCGCAACGTCTGCTGCAAGGGCTTCATCGTC
CACGATGGAATGTCTGTCTTCATGTTCAACCTTGAGGCGACATTCCTGGCCAGTCAGGTGTTGCCGACCGGCCGCCACGA
AATGGAGCGCTTCGGCACAGCTTGTGTGGAGATTCTTGCTGCCATGGTGGCAGATCCGCATGGGATTCCCGACATTATCC
ACTCAATGGCCACCGTCTTTGTCGAAGGCTGGGTCACAACAGACACAGCTCAGCCCAGTATTCTCAGACATGCCGTCGCT
GGCTGGGGCGTCACGCGCGAACACTTGTTCTTGAGGACGAGAACCCTTGTGGCTGCCATGTTCGGGATCCTCTATGCCAC
TATCCGTGGCGCTCATAGTATTGTTCAGGAACACATTGCCGACTTTGCCGTCTTTACAATTGACCAGGCACGGCTACAGG
AGGAGCGGGCCGTCTACAACCAGATACTGGGATTCATAGAAACTTTACGCTCTACCTACGCGTCAGCAACAGGTATCTCG
CAGGTGTTTAATGTCGTTCTAGAGAAGGCTCGGAGTAGGGGAAGCACAATCGTAGCCGAAATGCTTCAGACGCAGTTGGC
TCTTTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62