GenePrediction:GLEAN_7575 Details

Name: GLEAN_7575
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1224580..1222709 (- strand)
Length: 1872
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1224580..1223598 (- strand)
Length: 983
Type: CDS
Source: GLEAN
Position: GCSC_140:1223529..1223220 (- strand)
Length: 310
Type: CDS
Source: GLEAN
Position: GCSC_140:1223167..1222709 (- strand)
Length: 459
>GLEAN_7575 class=GenePrediction position=GCSC_140:1224580..1222709 (- strand)
ATGGTCGCTGCTGCTCCAAGCCAGTCAGCCGTGGGCCGGTATAGAGCGGAGAAGCCGCATGGAATTGTGGGCATGCTGCG
GAATCCGTACGTGTTCCTGACATGCGCGTTTGCGGCGCTGGGCTGTCTGATGTACGGCTACGACCAGGGGGTCATGAGCT
CGGTGCTGGTGATGGAGACGTTTGAGTCCGAGTTCCCGCACCTGCAGGGAAGCACAATCCAGGGCTGGCTGGTGTCGGCG
CTGGAGCTGGGCGCCTGGGCTGGGGCACTGCTCAACGGCTGGCTGGCCGACCGGATCTCACGCAAGTACAGCATGCTGGT
GGCCGTGCTGGTCTTCACGCTCGGCACCGGGCTGCAGTGTGGCGCCCACCGGAGCAGCGAGCTGTTTGCCGGTCGCGTCA
TTGGCGGCATTGGCATCGGCATGTTCTCCATGGTCATCCCGCTGTACCAGGCCGAGATCGCACCGCCAGAGCTGCGCGGC
TCTCTCGTGTCGCTGCAGCAGCTTTCCATCACCATCGGTACCACCATCGCCTTCTGGCTCGACTACGGCATGCACTTTGT
CGGCGGCACCCATTGCGATCCCGCCGGCATTCCGGCTGACCAGCAATATGACGACGGCGTGTTCAACTACACCCTTGCTG
CCGGCCACCGCTGTCTCGGCCAGAAGGATGTCGCCTGGCGTTTCCCTCTCGCCCTCCAGCTGCTGCCCGCCTGGATCCTC
TTCGTCGGCATGTTCTTCCTGCCCTTCTCGCCGCGCTGGCTCATGATGAAGCACCGCGACGACGACTGCGTGACTGCGCT
GTCCAAGCTGCGTCGTTTGCCTCCCAACGACCCCCTCGTCCAGGCTGAGTACCTCGAGATCAAGGCGGCTGTGCTCTTCG
ATGAGGAGGTCAATGCCGAGCTCACCGCCAGGGACGGCTGGATCGGCTCCTGGAAGATGCTCTTCACGCCCAATATCCTG
CGTCGGGTCTTGATTGGATGCATGTGAGTGTGAAAGAAAGAAAAAGACAGAAAAAGGCAAGAAAAAAGAGCAAAAGAGAC
TGACCCCCCAGAATTATGATCTGCCAGCAGTTCACTGGCATCAATGCCGTCCTTTACTACGCCCCCCAGATCTTCGAGAC
CTTTGGCTTCACCAACACCACCACCGACCTGCTCGCCACCGGCGTCACCGGCATCTTCCAAATCGTCTTCACCCTGCCCG
CCGTCTTCTTCCTCGACCGCTTCGGCCGCAAGACTTTTCTCATCGTCGGCGCCATCGGCATGATGATCTGCCACAATGTC
GTTGCCGCTGTCGACGGCTCCTTTGAGGACTCGTGGTCCACCCACCGGTCAGCCGGGTGGGCCTCTATTGTCTTTATCTG
GGTGAGCTTCATCCACCATTACTTAACTCTATCTCGACTACTAACCCCCTCAGCTCTTCGCTGTCAACTTCGCCTACTCC
TGGGGCCCAGTCGCCTGGGTCCTGACCCAAGAGCTCTTCCCCACAAGCATGCGCTCTCGTGGTGTCTCCATCGTTGCATC
CACCAACTGGATGTTCAACTTTGTCATCGGCCTGACCACGAAGGACATGCTCAAGTCCATGCGCTATGGCACATACATCT
TCTTTGCCGCCTTCTGCGCCATCGGCGCCGCCTTTGTCTGGCAGTTTGTGCCCGAGACCAAGGACAAGACGCTCGAAGAG
CTCGATGTCTACTTTGGCGGCGACGCTGGCGGCATCGCCGTCAAGGACCAGGAGCGCATGGCTCGCATCAACGCCAGCCT
TGGTCTTCAAGGTGTTGAGCGGCCCGAGGACCTGAAGACGGCCATTCCAACTGGCGCCGAGCTGCACGAGTTTGCCCCCG
GGCAGGGTGCCGATGTCGAGAAGACTGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62