GenePrediction:GLEAN_7576 Details

Name: GLEAN_7576
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1221464..1220253 (- strand)
Length: 1212
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1221464..1220990 (- strand)
Length: 475
Type: CDS
Source: GLEAN
Position: GCSC_140:1220884..1220253 (- strand)
Length: 632
>GLEAN_7576 class=GenePrediction position=GCSC_140:1221464..1220253 (- strand)
ATGGACACTACTCTCGTTGTTGGCGTCGTCGTCACTGCGGCCACGGCCCTGCTGGCGTACGGTCTGCCGCTCTTCCTGGC
CGAGTACTTTCCCTGGCAGCTGCTGTGGGCGCAGCGCAGCGGCCGGCCGACGGTGACGACAGCGTCGTATGGCGGCCGCA
CGGCCATGGTCACCGGTGCCAACGGCGCCTACGGCTCCCGGGCGGCCACGCTCTTTGCACAGCACGGTATCGGGACGCTG
GTGCTGGTCGACGTGCACGACTGCGCCGACGTGAAGCGCCAGATTGAGGCCGGCCTGCGCGCAGAGGGCAAGCCGGTGCC
CACGATTCTGGTCTGGCAGATCGACATGATGACCTTTTCCGGCTGCCAGGCGCTGGCTGCCAAGGCTCGTACGCTGCAGC
ACCTCGACCACGTCCTCCTGACGGCCGGCATCCTTGCCTTTCACCGGCGGGAGTCGCCCGAGGACTGGGAGACCAGTGAG
TAATTCCGGTCTTTTTTCTTTCTTTCTTTCTTTCTTTCTTATTTCTTTCTTGTTTCTTTTCTTTCTCTGCCTTCTCTCCT
CCTCCTGCTAACAACATCAGGCATCCAAGTCAATTTTCTCTCTACCGCCCTCATTGCCCTCTTGCTGCTCCCTCTGCTCA
AATCCTCGCCAGGCAATCCGGAGCCCCCGGTCCTCACTTTCACCACCTCTTTTGGCGTCTACCCGTCCTCCTTCACCATG
GGCTTGCCCCGGTCGCCGCACGCATCTTATCTCAAGCGCCTCAGCTCCAACCGTGATGGTATGGAACAGGCCCACCAGTA
CGGCCGCTCCAAGGCCCTGCTGCTCTACTTTGCTCGCGAGCTAGCTGCCCGCATTGCCAACGCGAATTATGCCGGCCGCA
TCGGCCGTGTGACCATCACCAGTGCTGATCCGGGTTCCGCCTGGACCCCTCTGACGAACCCCAACCAGAGCAAGCTGATT
CCACGTCTCATTATGAATATCAGTGCCCGCGACCCCCTTATCGGCGCCACTGCCCTTGTCAATGGAGCCTCTGCCCCCGG
CTCGGCTCACGGTGAGATCCTGCATGACTTTGACGCCGTGTCTTATCCGCCCTTCATGAACCGCCCGAGCGGTCGGATCG
CCCAGCAGCGGGTCTGGGAGGAGGCTCGGCGCGAATTTGAGGCCAAGGTGCCCGAGGTGGCGGCTGTGTTTGGGACTCTG
GATGAAGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62