GenePrediction:GLEAN_7577 Details

Name: GLEAN_7577
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1219683..1216663 (- strand)
Length: 3021
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1219683..1219398 (- strand)
Length: 286
Type: CDS
Source: GLEAN
Position: GCSC_140:1219295..1218472 (- strand)
Length: 824
Type: CDS
Source: GLEAN
Position: GCSC_140:1218410..1218037 (- strand)
Length: 374
Type: CDS
Source: GLEAN
Position: GCSC_140:1217608..1216663 (- strand)
Length: 946
>GLEAN_7577 class=GenePrediction position=GCSC_140:1219683..1216663 (- strand)
ATGGCTTTCTATGGTCGTGGAATACCGCTCCGCAAACATAGCGATGAGTCCGACAGCTCCGACAGCTCCGACAGCTCTTT
CGAACAGGAACACACCAACAAGGCCGAAGCAGTTCCTGTCTGGCTAGGTAACCTCCAAAATTGTCTGGACGCCGTCGAGT
CGGCGGGGGAATTTGCTGTTTTTGACCGCCACTCCGTCTTTGCGAATCCGGACCTGCATATTCGGGGCGATCGTTTCATT
TCCCTCCCTCTGACGCCGGGCGATGCTGAGATTCTCAAGGCCGCGTGTCGATAGGCACCCTTTGGGAAAGGCGACGCCAC
TCTCGTCGACACTTCTGTCCGCCACACCTGGGAGATGGACCACACCCAATTTCGGCTATCAAATCCAGCGTGGGAACCCT
ATTTTATGAAGATCGCACAGCAGGCAGCAGACCGGCTGGGACTTCTCGGCGTGGCTGTGCGCCCCTACAAGCTGCTGCTG
TACGAGAAAGGATCCTTCTTCAAGCGGCACAAGGACTCGGAAAAAGAAGCCGGCATGGTTGGCACCCTCGTCATCAGTCT
CCCTTCGCAGCATGAAGGGGGGGATGTCAGCCTTTCCTTCCAAACTGAGAGCAAGACATTTGCCACGAGCCCTGGCTCGT
CCTGGGACATCTCAGCTCTTGCCTGGTTTTCGGACGTGTCGCACGAAATAGCCGAGATCAAACAGGGTTACCGTCTGGTA
CTGACGTATAATCTGGTGCAAAACGGACCTGCTGTACAGACAGCGGAGTCTACATACCGTCAGCAGGAGAAAGTGCGGAC
ACGTCTCTTGCGGTGGAAGACCCAAATCCAGACGCCGGATCCTATAGTATACCCCCTCGATCACCAGTACACGGAATCAA
GCCTGTCGCTGGCGAACATGAAAGGACGTGATCGCGCCGTTTGTAACCTCCTGAGCAACTCTGCGGCTAGCTGTGGACTG
TTTCTTTTCTTTGCTCAGGTCACTCGCTCTCGAACTGAAGAATGCGGATACGATGAGTACGAAGATTCAGAAGTGGAAAC
CATGTTCAAAGCTCTTTTCACATTGAATGGCAAGGAGATTGGGTCGAATCTTACGGTGAGCGAATGCCAAATCATGGGCA
CCGATATAAATGACCGAGAGCCCGACAGTGAAGAAGAAGGAGAGTTCACAGGAAACGAAGGTGCTCCAACAACTTTTCAT
TATCATGACACTGTAGGTTCCTACCTATGAATATTGTAGGGCATCATCTCCTCACTAACTCGGCGTACTGCAGGTTGCAA
TGCTCGTTCGCAAGGAAGAACTTGTTCGCCTCACCCAGGGCGACAGGAGCGAAATGCATGCTGAAAATCTAGTGGCCCTG
GTCAATGAAGATCTTCAAGCAAGACGAAACGAGGCAATGACACAGTACGCATCTGCATGTCTGATCGACATTCTCACGAA
AAGACTCCGATCTCCTTCAGTTTTGCAGATCGCTCTGTATTGGGCTATGGAGCTGAACAATAGCAGGCTGATCGTAGCTG
CATTGGCCAGCCCGGCTGTATCATATGTTGGCTCTGGAACAAACAATAAAGAAGCAATACAAATACTCGCCGCCCTTGTT
GAAAGGGCGTATACAGGGACATCCGAAGACATCGACTGGGACAGACTGTAAGTTTCTTCGACTTAAAAGCCAGTACAGAG
AGATGCTCTTTAATATTGTTGTCTAACACTATAGAAGGTTGGGAGAATATGCAGCGTGCTGTTTTTTAACGCCCTGGGAT
GACTTTTCTAAAGACTTCTCTGCCCATCTCCGATCTCCAAGAATCCAAAGCTCGTTTAGATCGTGGGCTTCACTCAAAAC
CGACCAGATGTTTCAGTCAATGCCAGTACTCCGTGTGGTAGACTGCAACTTTGTTATCAAAAGCATAGAGTCTCACCGCG
ACACACCCGAATGGGTCATAACTTGGTGAGAACGTGGTTCTAGATATGCCAATTTCCTCCTCCCGCATGACCTACCATTT
GCCGCCACGGCTAGCTTTAGCATTGGTCTGGGACCCCGAAAGAAACGGCTGGCTAACTAACGGTTTTGTCACCAGGCTTC
TACCAACCTTGGCTGAGAGAGGCGAGTGGTCCTTGCTTCATCAAGTATTGCACATAATGTATTTTGGGAGAATCAAAGAG
CCATATTCAGGCATCGTGAAGGCCACTTTTGAACATCTGATCGAGCACTGTGCTTGGGCTCTGATACTTCGCGGGGGTGC
CCTATTCTTGACGCCGTGCCCAGCACAGTATTATACATACGACTTCCCGACACTACTGGACCACACTCTGGATATTGGAG
CTGGGGGTAGTGCTACAAAGCTTCTGGAGACGCTTTGCAATCGCTGGGGCGCAGAGCTGAAAAAGGGAGGGGGCTTTTTG
ACTGCGTCCCAGTCTATAACTCTGCTCGGAACAGTAGTTAAGGTTCTTCAAAAGCACAAGGTACTGAACTCTCCTCCAGC
GAAGAGATTGCTGGACATTGTCATTCAATATGAAATCGGCCGAAACATTCCAGAATGCCCAAAGAAGCTACCTGGTTGGG
CACATAAACCGCGGCGCTGCGATCAGGGACAATGCCAGGACTGTGTTGCTTTGAATCGCTTTCTCGTCTCGGAAAGCGAG
AAAGTCTGGCGCTTTACTGCCGTCCAAGCGAGACGGAAGCACGTCGAGTCTGCTCTAAAACAGGATTACCCTCTCCGGTT
CCAACTGGTGACGGAACGTGTTAAGTCACCGCAAACATTAGTCGTGGAAAAGTTGGAAATCGAATTTTCCGAGGAAATGA
AACCATACCTGAGTGCCATCAAAAACATGAGGAGGCATCTGGCGGCTCTGGAGGGGGATTTTGTAAGAGAGATGCTTAGC
GATGAAAGGTATCGAAAGCTCATCCTTCTTGAAGACTTGGACACGGACGATTCATCGGAGTATGTTGCGGCAGGAAAGAG
ACAATGGAACGAAGCTATTGGAGGCATACCAAAGAGAAGAAACCTGGGAGGCACTACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62