GenePrediction:GLEAN_7579 Details

Name: GLEAN_7579
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1204390..1203365 (- strand)
Length: 1026
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1204390..1204328 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_140:1204268..1204200 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_140:1204132..1203365 (- strand)
Length: 768
>GLEAN_7579 class=GenePrediction position=GCSC_140:1204390..1203365 (- strand)
ATGAAGTTCGCTATTCTCGCTCTGGCCACTGTGGTCTCTGCCAAGTTCCGCGCTACAACGACGGTAATTTTCTCCCTTCG
ACACCGCCAGCTTGTGGCACTTGTATTGACTGAGATTCGCAGCGCTACTACGACGGCCTTAAAGGTGCCTGCGGTTGCGG
TACCGATTCTGCTGGAGTCGCTTCATGGCAGGTATGGTTTCCGTACCCCCTTCGGTTCGCCCATAGTAGACTCGAGACTG
ACAAGATCCACCGCACAGCTCGGCACTAGCGATGGTGTCTACACCGCCGCCGGCTCGCAGGCCCTCTTCGACTCGAACGC
CAGTTCCTGGTGTGGTGGTGGCTGCGGCAAGTGCTACAACCTGACGTCTACGGGCGAGCAGGCCTGCAGCTCCTGCGGCG
CGGGAGAGACGACCGGCAAGAGCATCATCGTGATGGTGTCCAACCTGTGCCCGTACAACGGCAACGAGAAGTGGTGCCCC
AACGTCGGCGCGACCAACAACTACGGTTTCTCCTACCACTTCGACATCATGGCCCAGAGCGAGGTCTTTGGCGACAACGC
GGTCGTCGAGTTCGAGCCCGTCGCATGCCCCGGTGCTGCAGCATCCGACTTTGAGACGTGCCAGTGCCACGGCGTGCTGG
AGACCGACGAGACTCCGCTCGGCATGACCATCGGCTCGTCTGCCGGCACGACTGCTGCTGCCGGCACGACTGCTGCTGCC
ACTACCAAGTCCAGCAGCTCTGCCAGCCAGTCTTCTGCGCAGACCTCTGTCCACACGACCCTCACAACTGCCCTGGTAGT
CCCGGCATCGGCCTCGAAGCCGGTTACCAAGTCCGTCTCGAAGTCGACATCTGCTTCCTCGGCTGCCGTCAAGGCCTCCA
CGGTTCCCCACAAGCCTGAGGTGGCTACCGCCTCTGCCGAAGCCGTGAATGCGGCCGGCGCTGCAACGACGGCTAATGTT
TTCGGTGCGACCACTGCCTCGAGCTGTGCAGCAGCCCACACCTACACCCAGACCGTCTGGGTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62