GenePrediction:GLEAN_757 Details

Name: GLEAN_757
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1915464..1919816 (+ strand)
Length: 4353
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1915464..1918742 (+ strand)
Length: 3279
Type: CDS
Source: GLEAN
Position: GCSC_97:1918890..1919816 (+ strand)
Length: 927
>GLEAN_757 class=GenePrediction position=GCSC_97:1915464..1919816 (+ strand)
ATGCCGAGCTCCCTCCATCCCCAGGCGAAGTTCGACCCGATCCCGCCAGACCTCGACCTGCACGACCTCGTTGCCGACAC
GCCCAACTTCGAATGGGCCACGCACATCTCAGCTTCGGAAATTTTCACCCTCGGCCAGCAGCGCTTTGAGCAGCTGGTCT
ACGTCCATGTCATAAACGGTGGGAAGCCACTGGTGATCAACAACTGGAATGCCCGGCTACCGAAGCACCTGTTCAGCCCG
CAATGGCTGCAGGACAACTACAACAAGAAGGAGGAGAACGTGTGGGACATCAACAACAAATGCAATATCCCTATGACGAT
GGGTCACTACCTGCGGTCCATGAAGCAGCTGACCGACCAGTGGACGCCCCGAAATTTCCGCGACGAGCGCCGTCAGCGCC
TGTACCTCAAGGACATGGACTGCCCGCCCGAGTGGACCGATCGGCTGCGCAAGGCTCTTCCGCTCAGCATCTTCTACCTC
AACGAGAGCGTGGAGCCGCGGACAAGCAACGAAGTCATGGACGACGACGGCATGTTTGTCGACACGCACCAGGCAGCCCG
TGCCGGCGACTTGATGAGCAGCCTGCCGCCGGAGATGCGCGCCGAGAACCTCATGTGCTACATCGGCCACGAGGGCACAT
ACACGCCTGCCCATCGCGAGATGTGTGCCAGTCTGGGCCAGAACATCATGGTGGAGGCATCGGGCGCGGAAAAAGGCGAG
CGGCCGGGCAGCTCCATCTGGTTCATGACCGAGACCAAGGACCGCGAGGTCGTCGGCGAGTACTTTCTGTCAATGCTGGG
CCACGATGTCGAGATCGAGAAGCACTTTGCACAGATCAACGCGTGGAAGAAGGCCACCTTCCCGGTCTACATTGTCGAGC
AGCGACCAGGCGATCTGATCCTCGTACCGCCGCTGGCGCCACATCAGGTGTGGAACCGCGGCACGCGCACGATCAAGGTA
GCGTGGAACCGCACCGTGGTTGAGACGCTCGACATGGCGCTGCACGAGGCCCTTCCCAAAGCGCGGCTCGTCTGCCGCGA
CGAGCAGTACAAGAACAAGGCCATCATCTACTACACGCTCGGCAAGTACTACGCCGAGCTCAAGGTTGCCAGCACCGACC
ACCAGCTGGCGACGTTTGGCATCAGCCAGGATGTAGCGGGCAACTCCGTGCGAACGCAGCAGGTGGCCGGCGACTTCAAG
AAGCTGCTGCAGCTGTATGCCGAGATTCTCGTGGACGAGATGTTTGGTACCAAAGAGAAGAACGTTGAGTACATCCCGTT
CGACTCCAACATCACATGCTCGTACTGCCGGGCCAATATCTTCAACCGCTTCCTGACATGTACACACTGCACGCGGCAGC
TGGGCGAGGGCGAAGACGACACGTACGACATCTGCATGGAGTGTTATGCCATGGGCCGGTCGTGCGCGTGTGTGTCGGGC
CTGGGCTGGTGCGAGCAGTGGCCGTGGGAGGAGCTGGTGGGCAACTACGAGCGCTGGCGGACCATGGTAATCAGCAACGA
CGGCTTCATCGACGCGTTTGCGTCGCCGTCGGCCCTGCAGGTGGCCAGGCTGCGCACGGGACACAAGACCGTGGCGCAGA
TCTGCCAGGAGCAACTGCGGCGGCGGCCGTTTCGCGACATTACCCAGCCGCTGCCCACGAAAACGGACCGGGAGCTGTCG
GAGCCGGAGGTGGATGAGGATGGCCGAGTCAAGAAGAAGAAGAAGAAGCCGATACGCGCACCAAAGAAAGGCGACACGTA
CCGGTGCCACTCGTGCTGCCACAAGGACCACCGGTACCGGCTCGCATTTTGCACGACGCCCGGCTGCGTGGAGGCCTACT
GCTACGGCGTGCTGTACCGGGGCTTTGACATGATGCCGCAGACGGTGATGCAGCAGGAATACTGGAAGTGTCCGCGCTGC
CTGAAGATCTGCAACTGCGGCGCATGTCGGCGTGTCGGCCTGACGAAGCCGTACGTGCCCAAGAGCACGCTACTCGGCCA
CGACACGCGGCCGATTGCGGACGACCGCAGCGTGGAGTCGCTGATCAACTTCAGACTGCACAACCTGCTCTGGCTGCGCA
ACGGTGGCGAGGAGGGCCGCAGCAAGGACAGCCTGCGCATGCAGCGACTGCGCCGAGCAGCCGATGAGGCCAAGGCGGCA
CAGCCGGAGAATGGTGGGGACATGGGTGCGCACGGCATAGTTGCGGACGGCATGGTCGGCATGGACGACATGGACATCGC
AGATGGGGTGAGCGGCATGAACGGCGTGGACGGATATGCAACGCAAAACGAAGAGTACGACGGACAAGATGTTAGCATGC
TGAGCAACGGCTACGCGACCGATGCGCCGCAGTCGTCGTTCCCGGTGGCAGAGACGGCTCTGGACAGCCAGTCGCAGTCG
CTGCAGAACTACCCCGACCCGACTGGATATGCAGACCCCAACGAGGAGATGATGACAATGTTTGGCAGGGCGTACTACCA
AAACGACGACAGCCCCGACAAGATCCTGTTCGACCCGTACAGCGAGCCACCGCCACATCAGCTGCCGGTGGGACTGGAGC
TGATGGACGAGCCGCCCGAGTTTCTCGACAGCTTTGAGCAGAGGCCGGCACGACGCCCGCGGCAGGAGAAGGACATCGAC
CCCGACTACCGGGTACGGAAGCTGCACCGCAAGAAGGCACGGCCTCTAAGCGATCTGGAAATGCATCTGGACCCGGCGCT
CTTAACCGTAAACGCGGCCCCGCCAACGATGCCGAGCATGCCACAGCCGTCTGTGGTGTCGACGGTGTCGGCGGTGTTGG
CGGTGTCGGTGGTGGCCGATGGTGGCGGCAGCAACGGTGTGGCCAACCCTGCTTTGGCCGGCATGGTTGTCGATGCTGCG
GCCAACAGCGCAGAGCAGCACAGCACTCCCGTCACCATAGCCTCGGGACCTGCAGCACCGGTGGTGCCGGTGGACAATCC
GGACACGCACATGAACGGCTCGCACGCGGACAGCATGGCGGAAGTACAGGTGGCCAGAGACAACGAGGGCAGTGATGACA
GCGTCGAGAAGGGGCCGTCGTACGGCTTCCCGGCCAACGTGCCTGAGCTGCGGCACGCGCGACCAAAGAAGTCGTATGTG
GTGGAGATTGAGAGCGATGCGGACGACGATCTGCTGGACATGGATGCGTTGCTGGACATGGCAGCGTCTGCGTCTGCGGA
ACAGGCCGAAGCGGACAAGCAGCTGAAGCGGCCGGTAGCGCTAGCTGCGTCTCCCAAAGCAGCTGATGTTGGTGCTGGTG
TCAGTGATGATGCCAGTGCTCCTGCTGATGTCGCTGTTGCTGCTGCTCCTGCTGCTGCTCCTGCTGCTGCTCCTGCTGCT
GCTCCTGCTGCTGCTCCTGCTGCTGCTCCTACGCCGGCTCCGGCTCCGGCTTCGGTACCACGAAAGCGTGGTCGTCCGCG
GAAGTCGGTTGCTGGCTCAGACGCGTTGTCCGGGCTCCCATTCCACGGCCTGTCGAACGATGGGCCAACGGCTTCGATCT
CGCTGCCAGCCAAGCGTCGGACGAGTGTCAACCCACGCTCTGGGTCCGAAGGCGATGAGGAAAGCCAGGTCAGGCGTGGC
AGGCCACGTCGTGTCCAGCACAACAGCACGCCCACTGCGGTGGTGCCAGAGGCGCCGAAGCGACGGCCAGGACGTCCGCC
TAAGAAGCAGGTGTCCCCAGCTGTGCCTCCTACGCAGGTGCCGACACAGACACAGGTGCCGACGCAGTTCATGTCGATGG
CTGAGCGCATGGCTCTCCTGGGCAAAAAGTTCCGGATCAGGCGTAAGTCGCCAAAACGGGACCAGGAGGAAGCAGTGGTA
GCAGAAGCATCGGCAGGAGCATCTGAGTCCGAAGCCGAGACGCCAGAAAGCGTGCCGATACGGACGACGAGGCCGCCAGG
GATGTCCAACATCTCTGTGCGGATTGGGCCACCGGCGTTTGCGCGGGGACCTCAGCTACAGCAACCGGCAGTGGAGAAGG
TGGTTAAGAAAGGAGGAGGGACCGCAGTGGTGCTTCCCATGGCCAAACACAATGACGGGCCGACGGTGGTGCGACTAGAG
GAGTCGGATAGTAACAACGATGATGCGAACGATGACGAGAGCAGCAGCGGCAGCAACGGCAGTAGTGCAGCCGAGGAAAA
GCAGTTTCGCCAAGCCAGCCGCTCCAGCGGCAGCGACGAGTCAGACGACGATAGACGGCAGACTGCAGCTACCGGCCCCA
AGTTTTTTGCGCGACGAGGCGGCGGGCATGGCGGCGGGCGAGGTCGTGGAGGCCGTGGAGGTCGTGGACGAGGTCGAGGT
CGTGGACGAGAAGCGAGTTTTGGCAGGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62