GenePrediction:GLEAN_7582 Details

Name: GLEAN_7582
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1175858..1174745 (- strand)
Length: 1114
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1175858..1175797 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_140:1175531..1175442 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_140:1175388..1175046 (- strand)
Length: 343
Type: CDS
Source: GLEAN
Position: GCSC_140:1174861..1174745 (- strand)
Length: 117
>GLEAN_7582 class=GenePrediction position=GCSC_140:1175858..1174745 (- strand)
ATGACACTGACCCTCATAAGGGGTGCGAACGATGAAAAGCAGCAAGAAATGCTTGATCTAGCGTAAGGCGTAACGCGAAA
CTCCTCGAGAGGCATCCACTGTTGACATCAGCAGTCATCATTTTCTTACGCTTTGCCTGGGCGGAAAACTCCATTTGGCA
CCAATAGGGGAAAAGATGAAGGTTCCGTGTTTTTATTCATTTAGCGTTGTCAGAGCCTGACAAGTCTTGCAGAAAGCTCT
CGACATCGGCACGGGAACGGGAATCTGGGCCATGTGGGCTGAAGCCACCCCCTCTTTAGCCCGTGATTCATACTAAAACC
AGCTTAGTGATTTTGCCGACCAGTATCCCAACTGTGAGGTCATAGGCACAGATATTTCTCCCATACAACCTATCTGGTTG
CCCTCGAACCTGAACGTGTAGGTTCGAAGCACGGGACGTTTGCAACCTATTTACTTACGTACACAAACAGTGAAATTGAT
GATTTCACGCAGCCTTGGACATTCGACTCTGACTCCCTGAACTTTGTCCACGGGCGCTACCTGCTTGGCAGCATCGGCGA
CTGGGTTGCTCTGGCCAAGGAGGCCTACAAATGCCTAGCACCGGGTGGATACTTTGAAAGCTACGAAGCGTCACCCTTTA
TAGTCAGCGCAGACGGCACTGTTCCCGAGACAAGTGCAATGGGGCAGTGGGGAAAGATATATGAGGACGGCGGGAAGAAA
CTTGGGCAATCGTTCACCATTGTGCCCGACGGTGTGCAAAAAACAGCCATGGAACAGGCTGGCTTCGTGGATATCGAGGA
GTGGGTCTTTAATGTGAGTACAGTGTCTCGGCCGAGATGTTGCACGAAGCAGTTAATATTACGACAGCTGATCTAGACTT
AAGGCGCCTCTTGGACAATGGCCCGAGGACCCGAAATTGAAGGAAATTGGAATGTATGGCCAGTTAGCCCTCGAACACGA
CATAACCGGCTTCTTAACGTTTGTCGCAAACCTTCAGGGATGGTCTAAGGTGGAAATTGAAGCTTACGCTGCCCGCTTTC
GCCGAGACTTACGGAACAACGAGATCCACGGCACTATGATGATCAGAGTCATCTGGGGCCAGAAGACTGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62