GenePrediction:GLEAN_7583 Details

Name: GLEAN_7583
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1173540..1167791 (- strand)
Length: 5750
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1173540..1171705 (- strand)
Length: 1836
Type: CDS
Source: GLEAN
Position: GCSC_140:1171632..1171458 (- strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_140:1171401..1167791 (- strand)
Length: 3611
>GLEAN_7583 class=GenePrediction position=GCSC_140:1173540..1167791 (- strand)
ATGTCAGTGTACCGGGTTGCCGGTCTTCCGACGACGGTTTCGGGCGACGACGCAAAACATATTCTCGACGAGTTTTTCGG
CTTGGACGCGGACACAAAAATCCGGGCTCTTGGTCTGCATCCGCAAAGGCCATCGGTCGTTGCCATTGTGATGTTCTCCG
CCACTCCAGAGTTCTTACACGGCATGGGTCCTTGGAGGCTCGATAATGCGATCACATACGGTAGCCAGCTGCAGCACATC
CGACTCGAGATCGACACAGCTTTTCTCGGTTTCACGCCACTGAACATCGCGGGCAGCACGGAGGAAAACGGGATCGACTG
TTTCGTCGTCAGTGGTCTCAGCAGCCATCCATTTGGCTCTTGGAAGGAACGAGGCGGCCAATTTATGTGGTTGGTGGACG
ATCAAGACGCATATCCAGCGAATATTCGCATGCTTCTTTACGGCTACGACACGTCGCTTGTGGCAAGCAAGTCTTTTCAG
GACATTTCTGACATTGGCGAGAGACTCGCCATCTCGATTAAGAGTATGCGGAAGCCAGAGCGCAATAAGTCTCAGGTTAG
GCCGCGTCCTATCGTGTTTATTGCGCACAGTTTAGGTGGACTTATTGTCAAGGAAGCTATTTGTCATATGGCCACGAACG
ACATTTTCAATGCGAAATGTGTATATGGGCTCGTTTTCTTTGGGGTTCCGCACCATGGCCTCCTCGTCGAGCCTTGGCTC
CGCATGGTCAACAAACAGGCCAATGCGGCACTCGTCGAGAGCCTCCAGCCTGGTTCCCGCATCCTACAACGCCTGGACAA
ACATTTTAGGCGTGCCTTTTCGTTCCCAGGTCTAAAGGTGATTTCCGTGTACGAAACGCTACAGAGCCGGACCGTCCAGG
AGAGAGCCCCAGGAGTTTGGGATCGGTCTGGTGAGAGCCAAGTGCTCGTAAACACAACCTCTGCGGTGGGCTCGTGGCCA
GACTGCGTTTTTCACACGAAAATTCCCGTGAACCAGACCCATGAAGACTTGCCTAAATTTAAAGGCGCCTTCGACCAAGA
TTATCTGCTGCTGATGGACTACCTGGGAGACATGTGGAGCAGTGCAGCTACATTCGTGCAAACACGAGTCAGCACTGCCT
CTGAGCTAGATAACAACACGTCGCCACATCTCACCGATGAGGCCATAGGGGCAATGAAAAGAGCTAAGCCGCCACCCATT
GGTTTGTTTACTCTATGGCCCAATCCAGATACACAGGATGTCAAGAAGTTCCAGACGGACTTTGACGTGATCGCGATCCA
TGGCCTTTGCGGACATGCTTTCAATACGTGGATGGAAGGCGACAAACTTTGGCTTCGAGATTTTCTACCATGGGAGATGC
CAAAGGCCAGAGTCTTGACGTTTGGCTACGATACTGAGCAGGTGCTTATAAGTCCGACTTCTAATATCCGCGGCTCTGCC
GAACAGCTGCTGAAAGGCATCCGTCGGTTACGTCAAAAACACGACGAAAAGGCAGGGCGTAAAGCCATCTATGTGTGCCA
CGGTCTGGGCGGGATCGTGCTCAAACAAGCACTCGTCTTGGCCCACGAGGGCACAACGTTGTACGACGGGATCAGCGAAT
CGGTTGCGGGCATCATATTCCTCGGCACGCCGCATCAAGGCCCAGAGAAAACGTTTTGGTCTGATTACCTGAAAAAATTA
GCTCACATCTACAAGCCACCACGCAACTCGGTGGAAAGCCTCGAGATCAAATCTGTGGAGCTCGGAAACGCTTGTTTGCG
GTTTGGCGATTGTATGATGGGCTTGCAGATATTCAGCCTCTACGAACAAAACGTGGAGGAATCACTAGAATCTTTGGTCT
GCCTTCCCATCTTTTTGATGGATGTTTTCTCTTTGAGTGCTCTGCTAATTACGTATTTCTCGTAGCAGGTGGTGGATAAG
TCCTCTGCCATTCTTCACCTGCCTAACGAGACCCCTCTTTCCCTGAATGCGGACCATCGTGGCATGTGTCGGTTTCTCAC
CAGCTCTAGCAGCAACTACCTGACCGTCTACAATTGTATCTCGGAACTCATCGACGCGCCATCAAGTGACGCCGGACAGA
CGTGTAAGCAGCTCTCTGTACACCATGTTTAACAATCACTGAAACGTAACAATTACCAGATTTCGACCGTTCCGAGCGAG
AGTTTATGTCTAAACTTGGGGCAATTGACGAAGGAAAGGTTCTCGACCTGATACCGTCGCACTGGGGACAGTCTGCTAGA
TGGTTTCTTGACGACACGGAGTTTGAGTCCTGGACAAGGCTTCGAGGGCGTCAAGTTCTCTGGCTACACGGACCTCCCGG
TTCGGGTAAGACGGTGCTTATGCGGACTGCAATTTCGCACCTCAAGGTTCAGAGCGACATATCGGACAGTTCCATCATTC
GAAAGCCACTCCATTTTTTCTTTGACGACAAAGACTTAAGGCGAAAAACGACCTCTGCGTTTGTCAGATCTATTCTTAAT
CAGATCCTCCGTGACAGTCGGACTGCGTTCTTGGTCAGGTATCTGGAAGGCCGTGACGGAAAGAAAGATGCAGCCAATGA
GGAAAATCTGTGGATATGTCTCGAGATCATCATCCGTCGGTCACGAGGCATTGTGTTCCAGCTGGTTGTCGACGCTGTAG
ACGAAGTGCTCCGCAGTGATTCCGACGCATCCATCACCGTCATCGACAGACTCGAGCATCTCATGGCTCTGGATTCTAGC
GGGCGGCTCAGAATCATGATTTCTCACCGGAAGAGGCCGTCATACGAGTTCCCAAACGCCGATGTCGCCGTGCTTGACGC
GAACAACAACTATACACAGAACAATGTGTGGGACTACATTCAGGCCCACGTGCGAAAGTCTCTCGCGAGGTCCTACATTT
CTCCCGATGTTGCAGAGACGATTGAGCACAAGATCATGGAGGTTTCCAGCGGCAATTTCCTCCATGCCAAGCTGGCTTGG
GAGCAGTTCTCCAGAGGCGTCAGCCGATGGTCACGTGAGCTAATTCAGGACGGCCTGTTGCGACTAGACAGAGCCTCGCA
CGACCTCGTCGTTGTTTACTGCCGTCTGCTGAGAGCCATTCCCAGCTCGCAACGAAACAAGGCCAAAGCGTCGTTTGCCA
TTCTCCGCGTGAGCCGACAGAGGCTCACGTCCCGGCAGCTGGCATTCTTCGCGACCGTCTACAGCCAGATCCTGGATGAT
CGGCCGCTTCATCTGCGTGAGCTGGAGCTACAAAGTGCGGACTTTGAAAACTATTTGTCCGAATCTTGTGGCTACATGAT
CAGAAAAGCCGAGGATGGCACTGTCGATTTTTCACACGTGTCTGCAAAGGATCTGCTCACATGCAGCGTGGATGAGCTGT
CACCAGAAGACCAGGAGACCATCGCAAGCTACTCGGTTTCGGACCCGGATGCTCACAGCCTGCTGCAGAGACTGTGTGTG
TCTGTGCTCAAATTGGAAGACCGAGATGACAAGTCGTGGGATGAACTGTTGGACGCCGTAGCCAAGGCGGAGGATGATAT
GAAGAACATGTATGGCTACTTCGGAACAGACGAGCGCATACGCCGAATGCTTTTCTACATTGAGTCATTCATCCGGTCGA
CCGGACGAACACCTTGCTTTCTCTATGCCGTCCAGTTCTGGGTCACACATTACCAAGGCACAATGCCCAGCCGTAGCAAC
GATTGTCTTCTGGCTAAATTCTTACCCACCAAAACGGCCATCAGCTGCCACATTCTCTGGGCGGCCATCCAGCCGGAAAG
CGCGGCCGCATATCTGGGCACGTACCAAGACGTGCACTCTGTGCGTGGCAGCACGTCGGCCTCTTTGGCTCTGTTTCAGA
TTATGACTCGAGGTGACTGTCCGGGAATTGTCAAGGCCTTGCTTGCAGACGGCGCCGACATCAACGCTTTCGGCCCTGGC
CGAGACTTTATCACGCCGTTGTCGTGGGCTATTATCTGCCGACGACGAGAGTCGTTTCGGCTACTCCTGCGAGACGAGAA
CGTCAGCATCAACTACGGCAACTCACAGGAGCGAAAAGCCCTGCACTATGCAGCCCGCTGCTCTGAAGACGTCTATTTCA
CCCAGTCGCTGGTCGAGCATCCCCATGTTAACGTCAACATTATGGGCGGTCCTCTTGGCTCGCCGTTGCATCAAGCATTG
CACTCACACAACATAGCCGCAGTCCAAGTCTTTCTTGACCACCGCGATATTGCGATTGACATCAAAAACAACGAGGGTAA
AACGCCGTATTCCATGGCATATGAGAACGTGATTTGGCAGTCCATTCTGGAAAAGATGATCAGTATGGCCTCGGAAAGGG
TTCTGACCGCGACGACCAGCTCTGGAACGAGCCCATTTCTCACAGCCGGCTCTCACGGTTGGACGCGCATCGAAGAAGCC
ATCCTCAGGGCATACCCCAAGCAGCTTCTGCAGGTCGACCCACACACTAAGATGAACGCTCTGGCAACGTACGCGTTCTT
CGGCCGCAGAGAGAAGCTGCTGTGGATTTTGGAGAGGCTCCCGCCTGAAACAAAGCTGCGCCATGAGGGCGAGGAGTACG
ACCTGCTTCACCTCTGCGCCCATCAGAACTGGGAAGACGTGGTCCACTGGCTGCAGACAGAGTACGGCCTGCTCTCCCTC
CCCCAAGACCACACCGGGAGGACGCTGCTGCACTGGGCCCTGGAGCACAACTGGGATGCCAGCCGCCTGAGCCTGAGTGA
CTACAGCTCTGCAGAGCTCAATGCCCAGGACCATGACGGTCTGACGGCTGTACACATTGCTGTCGCAAATCGCAACATGG
CCGCCTTGGAGATGCTGGTGGCGTCTGGGGCCAGCTACATGTTGCGGGCCAAGAACGGCATGTCGCCAGTCCATCTGGCG
GCCGAGCAGGGCTACCGAGCTGCCCTGGAGTTCTTCATCGAGATGCCGGAGCGCGAGTTTGGCCGGACAAACACGGGAGC
CGGCCTTCTGCACCTGTTGGCCCTCTGGTTTGACGGTATGATAGTCAGCCGGTTTGTACGCTTTAAGCGAGCCCGGCTGG
ATGTCGTCGACAAACAGCGACGCACTGCGCTGCACTATGCCGCCATGGTCAACAACAGCGCTGCGGCCGAGCGTCTGGTC
GCCTTGGGCAAAGGCCGTGGCGGCAGCCAGTTGGAATCACGTGACTCCAGCGGAATGACGCCGCTGCTTGAGGCTATTCG
CAGCGGCGCCATCGAGACAGCCGAGCAGCTCCTCCAGCTGGGCGCCAATGCCCGCGCGGCCGACGCATTTGGCCAGACCT
GCCTCCATCTGAGCTTCCGGTATGGCCACGGTGGCCTTGTCGCGCGCTTCCTGGCCATGAAGCTTGACATCCACGGCATC
GACCGGTTCGGTATGACGCCGCTGCACCGAGCCTGCAGCACCGGCCGAGTCGAGCATATCCGCGATCTGCGCCGGCGCGG
CGCCCGGTGGAATCCTAAGAACATCTATGGTCGATCGCCCATTGACCTGGCCGTCGAGTTCGGAAACGTTGACGCTGTGG
CCGCCATGGTCCGCTGGCTGCAGAACCGAGGCGCCAGCCTGGACCAGACACAACATCGGCTTCGCAACGCTCTCAAACTG
GCGTGCGAGTTGGAGTTTAAGAACATGGAAGACTTGCTTGTACGCGCTGGAGCAGAGATAGACCGGCGCAAGATCAAGGT
CAAACGTCTGTACATGTCTGGACCCACACCGGAACCAGGCCGTTGGGCACTTGTCATTCCTCAGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62