GenePrediction:GLEAN_7584 Details

Name: GLEAN_7584
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1162544..1161000 (- strand)
Length: 1545
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1162544..1162422 (- strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_140:1162364..1161998 (- strand)
Length: 367
Type: CDS
Source: GLEAN
Position: GCSC_140:1161241..1161122 (- strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_140:1161037..1161000 (- strand)
Length: 38
>GLEAN_7584 class=GenePrediction position=GCSC_140:1162544..1161000 (- strand)
ATGGCAGCCCCTTCCGAATCCCCAAAGTCTTATTTCCCGCTGGCTGGCGGTGCTGAAGATGGCTGGTCGAATGAGCACGA
AGCCACAGCGACCTGCTTTTGCGGCAGCGTCCAGCTCGTCTTTGTAAGTCAGAACATTCGTCTGCCCCATACTACCTACA
TATCTAACCACGCCATGCAGCCAATCAAGGGACCAGGCCTCCTCGCCACATTTGTCTGCAATTGCAGCGACTGTCGCAAG
CTCACGGCTTCCATGTTCGCCTCAAACTTTTCCGTGGCTGACGACTACCTTCGCCACGTTCGTGGCCGTGAGAAACTTAC
TGCCTTTGGCCAGTCAAAGACGGTCGAGTCCGGCGGAGTAATGACAAACTACTTTTGCTCCACATGCGGAACGCTTATGT
ACCGCGTCGGCTCCAAATACCCTGGCATGCGCATTCTGCGTATTGGTACCGTGGACGATTTCAGCCTCCACGAAACAGCT
CTGCGTCCGCAGGTCGAGCAGTACATCAAGGATCGGGTCGACTGGTTTTCAGGAGTCGACACCGCCCGTAAGTGCCAGGG
CAATTCTTTCACTCCAGTCGATGAGACAAAAAGCAATATGTAGTGTGCGAGAGGATGCATATCAATGCGGACGCTAAAGA
CGCCTATCAAAATGGTCAATGAGAAAAAGTTAGGTCCTAACCGGAATCGAACCGGGGCTACTGGAATTATCATAATGATC
AGAATCCAATGTCCTAACCGCTAGACTATAGGACCTTTCGCTTGCTGTTATAATTTTTCCGTACCATTGGGGATTTTGGC
CTCTTGCTTCGATAATTGTGTGCAGATACGTATTGATTATACTTATCATGTTAAGAACTTCAGCCCAAATATATTTTTCT
GCTCCATACCGCGCTCTTTCTAAACGCGAAACAGCAGAAACCATGTCGCAAAATTGAGGCTGGATCCTCGTCGCGGGTTG
GCAATCCATTTACCAATCGCTTTGAGGCAAGATTAACAGTTTGCATGTAGCTGAATAGGAGGGGTTGTACTTAACTAGGG
TAGGTCACGAGGTGCAGTAAAAGCGGAAACATATGCTGTCTTACTCTCCGTCAGCTTGGTCGGACTTTGGTTTCTTAAGT
TCTTAAGCGTCTTCGCCTACATCAACAACTACTTGACAATCACTGTTGTTTGGTAATGTTTACAATCCTGGTTCACTAAT
TCTCTGACTTTTTAAATAAACAAGGCGCCCCCTTCTACGAACGTAGTCATACAAATCATTTGCTCGTTCTTGCAACAACA
TGCCCGATGACATCCTTATGCAGGTCTTGTGCGAACACCGTGGGCTCCCGAGAACCTTGGTGCCGTGCAAACAAGCCTTA
TCGGAATGTATGCTTTCGATGTGGTTGGTGGCACTGCTTTTGCCCGGACAATGTCGATATCAAGTAAGGTAAAGGAAGAG
ATCTTAACCCTGAGGATTACTCGAACATGATTCCGATTTTCCGACCGAAGGCTTCAACACATTTCAGAGCACTCTGGCAA
GACAGAGTCGTGCGATGGTCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62