GenePrediction:GLEAN_7585 Details

Name: GLEAN_7585
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1160124..1158540 (- strand)
Length: 1585
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1160124..1159670 (- strand)
Length: 455
Type: CDS
Source: GLEAN
Position: GCSC_140:1159612..1159075 (- strand)
Length: 538
Type: CDS
Source: GLEAN
Position: GCSC_140:1159016..1158540 (- strand)
Length: 477
>GLEAN_7585 class=GenePrediction position=GCSC_140:1160124..1158540 (- strand)
ATGAAGTACTCTGCCATCTTGACCATATCATGGGCTCTGGCCACGTCAGTCGCCGGTGCTGCCATCGACGACTGCCTCTT
CAACTCTTCAGTCCCGGTGGACCCCAAGGGCAGCACGGTCTGGTACGAGGATGTATCAGCGTTTAACACGCGGGTGCAGT
ACCAGCCCGCGGCCATTGTGCTTCCGAGGACTGTGGCCGATGTCCAGGCGGCCGTGGCCTGCGCAGCTCGGCTGGGCGTC
AAGGTCAATCCCAAGGGCGGCGGCCACAGCTATGGCTCGTTTGGCCTCGGTGGTGAGAACGGGCACCTAGTGATTGAAAT
GGACCGGTGGGACAATGTAACGCTCGACACGACGACCAACATTGCCACCATCCAGGCTGGCGCTCGTCTCGGCCATGTCT
TTACAGAGCTGCTTAACCAAGGCGGCCGAGCCATCAGCCACGGCACATGCCCAGCGTGAGTTTCACAATGACCTTCTGGC
CTGTTTTAATGGAGAGAAACTGACACGCACAGAGTCGGTGTTGGCGGACACTCGCTGCACGGCGGCTTCGGCTTCAGCTC
CTTTACACACGGGCTGGCACTAGACTGGATGGTCGGCGCGGACGTCGTGCTTGCCAATTCCAGCGTGGTGCGGTGCTCGG
CGACAGAGAACACAGACCTGTTCTGGGCGCTGCGGGGCGCCGGTTCATCTTTTGGCGTGGTGACGACGTTCTATTTTAAC
ACGTTTGCGGCACCAGCCAAGACGACCGTCTTCCAGGCGAGCTTGCCGTGGAACGCCAGCTCGTGCTCCAAGGGCTGGGC
AGACCTGCAGGACTGGATCGTATCGGGCGGCCAGCCCAAGGAGATGAACATGCGCGTCTTTGGGATGCAGTCGTTCACGC
AACTCCATGGCCTCTACCACGGCGACAAAGCAGCGCTCATGCAAGCCATCCAGCCGTTGATGGACAAGCTTGGGACGTCT
TTGTACCAGGCAGACGAGACAGATTGGTACAATGGTTTCCTTGCCTACGATGACAGCAAGACTGTTGATATCACCAACTC
AGAGTCAAGGGTTCGTATTCTCGTCCGCTAGCCTCTCTTCCAGAATCGAGTTTTACTAACAAGTGCAGAACGACACGTTT
TATGCAAATTCGCTCATGACGCAAGCCATGCCACCCGCCGCCATGCAAGACGCCTGCTCGTATTGGTTTTCGGAGGGCGC
AGCCAACAGCCGGCCATGGTTTATCATCATCGACATGTTTGGCGGCAAAAACGGGTATATCACCAATACGCCAGTGTCCG
AAACATCGTTTGCGCACCGTGACAAGTTGTACCTCTATAACTTTTACGACCGCGTGGACTCAGGCACCTATCCGGAAGAC
GGCTTCGGTTTCGTCAAGGGCTGGACCGAGGCTTTTACCCGGCAGCTCGCTGCTGGCAGCTACGGAAAATATGCCAACTA
TGTCGATCCTGCCATGGACCGGACGTCCGCGGAGCAGGCCTACTACGGAGACAGCCTTTCAAGGTTGCAGCTTATCAAGG
CTGCTGTAGATCCCAACCAAGTGTTTGATTATCCTCAAGCAGTTGTGCCGGCATTTACGTCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62