GenePrediction:GLEAN_758 Details

Name: GLEAN_758
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1926945..1927471 (+ strand)
Length: 527
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1926945..1927055 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_97:1927163..1927471 (+ strand)
Length: 309
>GLEAN_758 class=GenePrediction position=GCSC_97:1926945..1927471 (+ strand)
ATGACCGACAGCCTCAACCTCAACACGTTCCGTGTCAAGTTCGAAGCCGGCCGTTCTTTCGATCTAGAAGATGACATGGA
GTTTTGCCCAGGCCTGCTGTCTGAAAACGACGTAAGTTATCACTTGATTCGTCCATACGGATGATGACTTGTCCTGCGCG
TCGCTGTTTTGTCTGGCATCGCCCTCGTGACTCATATTCTTACGCACCTCCCTTCCAGTTGGTTTCCATCCACAGTTCTT
CTGAGCGCTCGTCACTGGCTAGCAATTCTCCGGAAAACTCGCCGTCTCAGCCATCGCAGGTGGCGCCAATCTTCTCTCTG
AACGCATCATCACCTTCATTTACTCTCCCCACTCTGACGCAACAAGCAACGAAGCTGTATCAACCTGCGGCCACTCGCGC
CCGCAATCCTATTCCGATTGTTCACCCTTCGTCGCGCCCAGCATCGCACATTAGCATGTCTACTCCCATTCCGCCTTCTG
GGTCCCCAGGCATGCGCATCCCGCAGCAGATCGGTGCCGTATGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62