GenePrediction:GLEAN_7592 Details

Name: GLEAN_7592
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1133497..1132087 (- strand)
Length: 1411
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1133497..1133133 (- strand)
Length: 365
Type: CDS
Source: GLEAN
Position: GCSC_140:1133083..1132384 (- strand)
Length: 700
Type: CDS
Source: GLEAN
Position: GCSC_140:1132332..1132087 (- strand)
Length: 246
>GLEAN_7592 class=GenePrediction position=GCSC_140:1133497..1132087 (- strand)
ATGACACGCACGTATCTAAAAAAAGCAATCGATACGGCCACTACAACCTCGTCGTCATCGCCCGACGTGCCCGTCATCGT
CAAGGACGTCATCGACACGATCCGTCGCGACGGCGATGCGGCTGTGCGGCTATATAGCGAAAGGTTTGACAAGTGGTCGC
CGGCCTCGTTCCGGCTCTCTCCGGCCGAGATCGAGTACGCCATAGCCCAGGTGCCAGCGCAGACGATCCAGGATATCAAG
GACGTGCAGGCCAACGTGCGGCAGTTTGCCGAGGCGCAGCGTCGAACCATTACCGACTTTGAGCTTGAGACCGCCCCAGG
CGTCTTTCTGGGCCAGAGGAACAACCCGATCGAAAGGGTGGGAGCGTGAGTTGACTTGTCTTGTTCTTGCCTTGTCTCGT
TACTGACATCACAGCTACATCCCCGGCGGCCGCTATCCCCTGCTCGCGTCTGCCCACATGACCATCCTGACGGCCAAGAT
TGCTGGCGTCAAGTCTGTCGTCGCCTGCACGCCTCCGGATCAAGGCCGCATCCCGTTTACGACCGTGGCGGCCATGCACC
TCGCTGGCGCCGACGAGATCTTTATCCTCGGCGGCATCCAGGCCGTCGCCGCCATGGCTGTCGGCACCGAGACCGTGGCC
AAGGTCAGCTTCCTTGCCGGGCCTGGAAACGCCTTTGTGGCTGAGGCCAAGCGTCAACTCTACGGCGAAATCGGCATCGA
TCTCTTTGCCGGACCCACTGAGATCCTCATCGTGGCCGACGAGACAGCCGACCCGTTGCTCGTCGCCACCGACCTGCTCT
CCCAGGCCGAACACGGCCCTGATAGCCCAGCCGTGCTCATCACCACGTCCGAGCAGGTCGGCCGTCGCACCATCGACCAC
TGCGCCGCCCTCCTTCAGACTCTCGTTACTGCCCCTATCGCCAGCGTCTCCTGGGGCCGCCTCGGCGAAGTTGTCCTCGT
CGACTCCATCGATGAGGCTTACAAAGCCGCTGACGAGCTCGCCTACGAACACGTCCAGATCCTCACCGCTTCGCCCCGCG
ACGCCCTCGACAAGATGACCAACTATGGGGCCCTCTTCCTCGGACCCATGACCTGCGTGTCCTACGGTGACAAGGTACGC
TCCCTCTCTGGCAGAGCTTGTCCTCCCCCACACTAACACTTTCAGTGCATTGGCACAAATCACGTGCTGCCAACACGCGG
TGCCGCCCGGTACACCGGTGGTCTCTGGGTCGGCAAGTTCCTGCGCACCATCACCTACCAGGAAGTGCGGTCCCCCGACG
CCAGTGGCCGTCTCGGCCGTCTCTGTGGCCGAGCTGCCCGCACAGAAATGTTCGAGGGCCATGCCCGCTCCGGAGACCTG
CGTGCTCATCTGTACCTCGGCGACCAGTACGACTGGATCAAGCATGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62