GenePrediction:GLEAN_7593 Details

Name: GLEAN_7593
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1126958..1126490 (- strand)
Length: 469
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1126958..1126929 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_140:1126865..1126832 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_140:1126757..1126629 (- strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_140:1126536..1126490 (- strand)
Length: 47
>GLEAN_7593 class=GenePrediction position=GCSC_140:1126958..1126490 (- strand)
ATGCCGCGGGAAGTCGGAGACATCAAGCAGGTGTGTTACTAGCTACGCGCTCCTATTTATACCAGTGGTGATTCTGACTT
TTTTCGTCTTTAGTTCATTGAGATCTGCCGGCGTGAGGATGCGTCCTGTAAGTTGCGCTGAAAGCCAACAACACCCGCGT
CTTCGAGACACCTTGGAATTTCGAATCTAACAAACCATCAGCTGCTCGGATCAAGAAGAGCAAGAAGACCAACGTGACCA
AGTTCAAGGTCCGGTGCAAGCGTCACCTTTACACCCTGGTGCTTAAGGACTCCGACAAGGCCGACAAGCTCAAGCAGAGC
CTCCCGCCGAGTACGTTTACAGCATAATTTGAACAGAGAGAACTGCTTTGGGTCTCCCAACTCTGTTTCTCCTTATTATT
ATTTTACTAGCTAACGTATCAGCCCTGACGTTGACCGAGGTCACCAAGAAGGAGAAGAAGACGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62