GenePrediction:GLEAN_7595 Details

Name: GLEAN_7595
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1122560..1120780 (- strand)
Length: 1781
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1122560..1122515 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_140:1122456..1121788 (- strand)
Length: 669
Type: CDS
Source: GLEAN
Position: GCSC_140:1121723..1120780 (- strand)
Length: 944
>GLEAN_7595 class=GenePrediction position=GCSC_140:1122560..1120780 (- strand)
ATGCCACCAAAGGCCAAGGTCACGCAGAGGGCCAAAGAAGCAAGTAGTACGCGTTTTTCCCGTCCCCCTCTGTCTTGCTT
CTGCACATACTCACAACCTGACAGCATCTGGTCCTTCGGTCTCACCACCACAACCGCCCCGAACTGTGAACGAGCAGACT
CGGGAACGCTACTATCTGGGACGTCCGTACGCAAAGTCAATAGACAAGGCAGGGGTTAGCAGTCTCTCGCCGGCTGAGCG
TACATCGTGGGCAACCGCACAGTATCTGGGAGCATCTGCAACATCTGCATCGAGGAAGCGGCCCGTTCTCTCCAACAAGA
CGCAAAAGGAACTCTGGCGACACGCAAACGAGGCCAGTCTGCCGCTTCGTGCTCTTAAGAAAGCCCCCCCACCTGACACT
ACGTCAGGCCCGCCCCCAAGTGGTCCTCCTTCTGTCTGGGGCCGTGACCGATCCGGTCGCGACGTGGGCACCTACAGCCT
CGACGATTTCCGCGAGCGCACTGCCCGCCGTGTGCGTCTGACTATACTCGGGGTCTCTCACTGTGCATTTCTTGCCAAGC
GAAACACGTCAAGTTCCGACATCACGCCAGAGGACATACAAGCAGAGAAGCAGCGGCGTGCCGAGATTGCAAAACTGCAA
ATGGAGCTATACGGACAGCGAACCGGCGGGTCCTACGCGCAAGACCCAGAATGGGACGACGTCGAGCCCGTTGCGATTGT
CGAGCCTGAGGGCGCCCTCGCAGCCATTGCATACCCTGAAGCCTACGGCGAAGGTACACCTGTCCTGTTCGTTTTGGATC
ATTGATGTGTTGCGTATGCTGATTTTTGCACTGTTAGCAATCTCATACTTGCGAGCAGTCATGGCAAAGCCGGAATACTC
GCCACGCTGTCTGAGACTGACAGAGTTTATCATCTCGCTCAACCCGGCGCACTACACCGTCTGGCTCTACCGGTTTTCGG
TCGTCAACGCGCTGAAGCTACCGGTGACGGGAGAGATCGAGTGGCTCAACGAAGTGGCGCTGCAGAACCTCAAGAACTAC
CAGATCTGGCACCACCGGTACCTGCTGGCGGAGCTCCACTACTCGCAGATTGCTGACTCACCGGAGCGCGTGGCTGCCTT
TGCCCGCAGTGAGGTCGACTTCCTCACGATGATTCTGGCGGAAGACACGAAGAACTATCACGTTTGGTCGTACCGGCACT
ATCTCGTGCGCAAGCTTGCGTACTGGACCGCAGACGAGCGGATTGCCACAGAGGCCTTTATCCGACAGGACGTGCGCAAC
AACTCGGCCTGGTCACATCGCTTCTTCCTTGTCTTTTCGGACCCTGCAAACTCTACGCCGGAAGATGCAGCGTCGACGGG
CGAAGATGGCGACGGCTTGGAGACATCGCTGGGCAAGCTTAACATCGGTCACGACCCGGCGGTGCCGGAGGCGATAATCG
AGCGAGAGATCCGTTATGCCAAGGACAGCATTCATAAGGCGCCGCAGAACGAGAGCCCGTGGAACTACCTCAAGGGCGTG
CTGTCCAAGGGCAACCGGCCGCTGGGATCGATCGAGGATTTTGCGTCGCAGTTTGTGGGGAAAATCGGCCAAGGCGACGA
GGAGGTTGTCAAGAGCACGCATGCGATGGACGTGTTGGCAACGATTTATGGAGAAAAGGGCGACATACCGCTAGCCGACC
TCTACCTAGAGCGCCTGGCCAATAAATGGGACCCCATCCGGGCTGGCTATTGGGAGTACCAGCGAGAGCAGCTGAAGCAC
GGTGCAGGCAAAACGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62