GenePrediction:GLEAN_7597 Details

Name: GLEAN_7597
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1117017..1116144 (- strand)
Length: 874
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1117017..1116996 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_140:1116936..1116857 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_140:1116773..1116144 (- strand)
Length: 630
>GLEAN_7597 class=GenePrediction position=GCSC_140:1117017..1116144 (- strand)
ATGAAAGTCAACGAGACGACAGGTAACCGGCCTGCCCTTTTACGTCTTTTGGTGGCCTACCCAGACTGACACGCTGGTTA
GCCATCTCGACGTCACGTGTCCTCCTGGTGCCGTACGACAGCCATCATGTGCCGACGTACCACGACTGGATGGAGGACGA
GGTAGGAAGGCGCGGGTCGTTCTTTCTGTGCGGCGCATCGGCAGCAGCTCTTTTTTCTCTCTTTTTTTGCTGACTAAGAA
TCAGGCTGTCCGCGTGGCCACGGCATCGGACCGACTGACGCTGGCAGAGGAGTACGAGAACCAGGTGGAGTGGCGCGCCG
CCGCCGACAAGCTGACGTTTGTCCTGTGCCGGCCGCTGGGGGAGCGGGATGAGAGCAGCAGCGGCGGCGTCGTGGCGGGC
GTGGACGATGTGCCCAGCCGCATGGTTGGCGACATCAACTTTTTCCTGCACGTGTGGGACGACGAGGACGACAATGACGA
AGACCACGGCGGCACAGTCGTGCTGTACAGCGGCGAGGTGGACGTTATGATTGCGCGGGCGGAGGACCGCGGCCAGGGGT
TTGGCCGTGCTGCCGTCACGGCGCTCCTGTACTTTGTCTTGCAGCGACATCGAGAGGCCATCCTGGCCGAGGCGGCAGCA
GGAGCAGGAGCAGGAACAGGAGCCCGTGCTGGCAAGCTACGGCGGCTCGTCGTCAAGATTCAGGCGACCAATACAGCGAG
CATCGGCCTGTTCACCGGCCTGGGTTTCCAGCAGCGCGGGTCTGTCAACTACTTCGGCGAGGTCGAGCTGGTGCAGGACA
TTGTGGATGGAGGGCAGGTCCCAGAGGGCTATGCAGAACTGGAGTATATTCGGAGAGAAAGGGTCAAGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62