GenePrediction:GLEAN_7598 Details

Name: GLEAN_7598
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1110340..1107065 (- strand)
Length: 3276
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1110340..1110304 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_140:1110175..1108602 (- strand)
Length: 1574
Type: CDS
Source: GLEAN
Position: GCSC_140:1108551..1108341 (- strand)
Length: 211
Type: CDS
Source: GLEAN
Position: GCSC_140:1108278..1107351 (- strand)
Length: 928
Type: CDS
Source: GLEAN
Position: GCSC_140:1107293..1107065 (- strand)
Length: 229
>GLEAN_7598 class=GenePrediction position=GCSC_140:1110340..1107065 (- strand)
ATGGTCTTATCTATCCCGGACTACAACATGGAGAGACGTGAGTGTTTCCCCCTTGCGACTCTTCTCGTCCTTGTTATTCC
ATAGCCATGTTATACGCTCTTGTCCGTCGTACTTGTCCTTTAATGACACTGTGGTCTGTTTGACTGATTCGTCTCTGTGA
GCCAGGTTCAAAATCCCTGGTATTAAAGCCTTCCTCAGATGCATCCTCCAATACCCCCGCCAGTGCCCCTGGCAGAATAA
CCCGATCCCGATCGAAGACGGCAGCCTTTGGTTTAGATGGAGCTGTATCGTCTGGAATCAGTAGCGAATCTGTCTCTACT
GTTCCTACGCCAACAAATGCCGGCTCAGAAAACGGCGATCAGACAACGCCGCCCACTAGCGATACGAGCACCCCGATTCT
ATCCGCAGGCGTCAATGATCTATCTCCGCTTCCTGGCTTCCAGCCTGCGAGCTCTCTTCCCCGGCTGGAAATCTCACTGC
CCGGCTGTGCATCTCCCGTGCTTGCCCCCGACAGCATGAAGGCTCTTAGTAAAAGCAAATACTCTCTGAGCTCAAAGCGC
AAGCGCGACGTCTTCAATAGTGACGAAGATGACGAAGAGGTGGAGTTTCTGCACGTGGACCGAGATGCCGTTTTGGCCCG
CAGGCTCCAAAAGGAGGAGGACATGCGGCACAACGTTCTGGTCCCCACAGCAGGATCATCTTACTCGAGGCGTGCGGGTC
CTGGTGGGCGGAGCCAGACTTCGACGCTTGCTAGTGCACCGACCATGAAGCTCGAGCGTGATGGCAGTATCCCCTTCCGG
CAAGGCCAGACGGCTCTGTCTCAGGACGCAGATATGATGGAAAATTGTGGGTTTATCGACGGCCTGTCTGCGAATTCCAC
TGCTAGAACAAAGCGGCAGAAGCAGCTCAAGTCCACCCGAAGCAACTTTGACAGTCCTAATGTTGCTGGACCGAGCAACT
TGGACAGCGAACGATACGTGGGCGTGCTTTGTCTATCAGATGCTTCTTCGGATTGCCAAGCAGATCCATCATCACCTACG
GCCTCGGATATATATTCTCGGTCAGAAGCTTCTTCTGATATACAGCCAGACCCACCGTCTAGGGCCTTGGACATGAATCA
GCTTGGAACCCGCCGTCAATATCGGGACTATCGCAATACAAAGCGTGTCAAGGACGACAGGGGCCGACTAGAGGACCAGC
ATCCCATCCTCAAGTCCATGTGGAAAGACTTGGAGGATATGCCTATTCTCAAAGCCGGCCGGGCTGATCAGCCAGCGACG
ATATCACGCAATCTCAAACCCTTCCAACTTGAAGGCCTGGCATGGATGATAGCTATGGAAAAAGCCAAATGGAAGGGCGG
TCTTTTGGGTGATGAAATGGGTTTGGGCAAAACCATCCAGGCAGTGTCCCTCATCATGTCGGACTATCCAGCCAAAAAGC
CGACGCTGGTCCTGGTACCACCCGTGGCGTTGATGCAATGGACGACTGAAATTGCATCGTACACTGACGGACGCCTCAAA
ACGTTCATCTACCATGGCACCAACGCCAAGACGAAAGGCATGACAGTGAAGGATATCAAGCAGTACGACGTCATAATCAT
GTCATACAACAGCTTGGAATCTGTGTACAGAAAACAGGAAAAAGGCTTCGTCCGCGTAAAGGGAGTTTACAAGGAAAAGA
GTGTCATTCACCAGACGAGTTTCCACCGGGTCATTCTCGATGAAGCTCACTGTATCAAGGTATGGCGCATGCTCACCTCC
TTTCTGTTCCCTAATCTGACCATGCTTAGACACGAAGCACGATGACAGCCAAGGCTTGTTTTGCTCTGAATGTGGACTTT
CGCTGGTGTCTCACCGGAACTCCGCTCCAGAACCGCATCGGGGAGTTTTTCTCTCTTCTCCGATTTTTGGTAGTCGAGCC
GTTTTCGAACTATATATGTCGAGACTGCAAATGTTCCAAGCTCGAGTGGTCTGTGGACGAAAACAACTACTGTAGACATT
GTGAGTCTGTAGTTTATGGGTTTGCGCCTGACATTTTTATCTCGCTAATACATCTCCTGCAGGCAAGCACAGAGGTATGC
GGCATCTATCCGTTTTCAACCAGGAGCTTCTCAATCCGATCCAGCGTTATGGAAACCTTGGTCCCGGACAATCTGCTTTC
AGGAATCTGCGCCTCCTGACAGACCGAATCATGCTTCGGCGTCTGAAGAAAGACAATACAGACTCTATGGAACTGCCGGT
CAAGGAAGTTGTAGTGGACCGCCAGTTTTTCAGCGAAGTGGAAACGGATTTTGCCAACAGCATCATGTCAAACACACAAC
GCCAGTTCACGACGTACGTCGAAAATCGAGTGATGCTTAACAACTACGCCAACATTTTCGGCCTGATCATGCAGATGCGC
CAGGTTGCAGACCATCCAGACCTCATTTTGCGCAAAAATGCAGAGGGCAGCCAGAACGTTCTGATCTGCTGCATCTGCGA
CGAACCGGCCGAGGAGGCGATTCGGTCCAAGTGCAAACACGACTTCTGTCGGGAGTGCGCTAAGAGCTATCTGCACGCAA
CCGAGCAGCCGGACTGCCCGCGTTGCCACATCTCACTCTCCATCGACCTGGAGCAGCCGGAAATGGAACAGGACGAGATC
AAGGTGAAGAAATCGTCCATCATCAACCGCATTCGCATGGAAAACTGGACGTCTTCTTCCAAAATCGAGCTTTTGGTGCA
CAATCTCTACCGTCTGCGGTCAGACAAGGCGTCGCACAAGTCGATTATCTTCTCTCAGTTCACGACCATGCTGCAGCTTA
TCGAATGGCGTCTCCGCCGTGCTGGCATCACGACCGTGATGCTGGATGGAAGCATGACGCCTGCACAGCGACAGGCATCC
ATTGAGTACTTTAAAGAGAATGTCGATGTCGAGTGCTTCCTTGTGTCGCTCAAAGCTGGTGGCGTTGCCCTGAACTTGAC
TGAAGCGTCTCGAGTCTTTATTGTGGATCCGTAAGTACCCTTTGTCTTGCCCGTTTTCGGCCTGACATCAACTAATTGTG
CCCGCAGCTGGTGGAATCCTGCCGCAGAGTGGCAGTCGGCCGATCGTTGCCACCGCATTGGCCAGACCAGGCCTTGCGTT
GTTACCCGATTGTGTATCGAGGACTCGGTAGAGAGCCGAATGGTCATGTTGCAGGAGAAGAAGACGAAGATGATCAACTC
GACTATCAACTCTGATGATGCTGCCATGGAGTCGTTGACCCCTGAAGATCTGCAATTCTTGTTCCGTGGCAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62