GenePrediction:GLEAN_759 Details

Name: GLEAN_759
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1936001..1938301 (+ strand)
Length: 2301
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1936001..1936214 (+ strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_97:1936276..1936356 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_97:1936419..1936626 (+ strand)
Length: 208
Type: CDS
Source: GLEAN
Position: GCSC_97:1936689..1937419 (+ strand)
Length: 731
Type: CDS
Source: GLEAN
Position: GCSC_97:1937491..1937537 (+ strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_97:1937597..1938301 (+ strand)
Length: 705
>GLEAN_759 class=GenePrediction position=GCSC_97:1936001..1938301 (+ strand)
ATGACGGCCCGCGACGACGAGGAGGCTTTCCCCCCGAGCCGGACGACGGCCGTGACGGCCAGCGGGGCCATGACGACAGC
AGCAGCGAGCGACGCGGAGGATGCGAGCGAACGGGCGCGACACGATGTCGACGCGCTGTGGCGGCGGCTGGATCCGCAGG
GCAAGGACCTGGACTTTAAGGGGCTCAAGAAGGGACTCCGGCGGATTGACCACCGTGAGTGCAGCCTCTTCCGGCGTGGC
CGTGCTTGTTTTGGGTGCGATTGCTGACGGGATAGCGATGAAAAACGCGGACGATATGCTGCGGCAGATCATCAAGCTTG
TCGACGCCGACGGCGACGGCAAGATCCAATATGAAGGTGGGACGACAGACACGCAAAGCGTCGTCAGTCCTTTGAGCTGG
CTCCCGCTGACAAGGCAGAATTCCGGGTGTTTGTCGAGACGGCCGAGCACGAGCTGCTGACGCTGTTCCGGTCGATCGAC
CGCGACCACGACGGACGGGTCAATCGGACAGAACTGCGCAGTGCCTTTCTCAAGACGGGGCTGTCGGTGCCGGTGAAGCG
GCTCAATGGCTTCTTTGACGAGATGGACGCGAACCACGACGGGTACATCAGCTTTGAGGAGTGGCGGTAGGTGTCCCTGT
CGGGGTGTCCCTTTGCCCAATGGCAAGCACAGCGGCTGACGTGTGCAGGAACTTCCTGCTGTTCATCCCGACGCGCGGTG
ACTCGACGCTGGCCACGGCCTTCTCGTATTATGCGGCCACGGTGGTGCTCAATGCCGAGGGCGATTCGCTGGTCAGCGAT
GAGACTCTGGAAGGCTTAGGTACGGCCGGTTCTCTCTTCTACGCCCTGTTTGGTTCTCTCTTGAAGCTTGCCCATCCATC
TGCGGCGGAACCGAAGGCCGTGTCGTCGCGGACGCGCGAATCGGAGCTAGACTGCGGGGAATCGGCCGAAGCACACACAC
TCACATCACAACTGGCGTCATTACCAGCGCCATCACCAGCCCTACCGCCCTCCCCCCGGCGATCGTTTGCGCCACCGCCG
TCAATGGAGGATGACGGGGACAACCCGGGGGGCTATGAGATCAACAGCCTGGACGATCTCGAAGACGGCGAGGTGGACGA
CGACAAGCTTCAAAAGACGCAGCAGGGGCGTGCAAAGATGTCCAAACTGACGCAGTACATGCCCCATCCAGGATACTTTG
TGGCAGGCGCGCTCGCGGGCGGGATCTCGCGGACGGCAACGGCGCCGTTCGACCGGCTCAAGGTGTTTCTGCTGGTCAGC
ACGCGGGCCGGCAGCAACGCGTCAATCAACGCGGTGCGCCACGGTCACCCGCTAGCGGCGCTGCACAACGCAGCGCGGCC
GATCACGGACGCGGTGGTGAGCCTGTACCGAGCAGGAGGACTGCGGACGTTTTTTGCAGGTGGGTGGTGGTCATGCTGCG
AACAGAGTGGACCTTGGAGGCGGTATGAGATGCACTCGCTAACAGCCCAGGAAACGGACTAAACGTGGTCAAGATCATGC
CAGAGACGGCGATCAAGGTGAGTGCAGCAGCACAGCCCAGCAGCACAGCCCGGCAGACAGCTGACCCCCCCCTTAGTTTG
GCTCGTACGAAGCGGCCAAGCGGGCCTGCGCCTCGCTCGAGGGCCATGGCGACCCAGCACACATCAACCCCTACTCCAAG
TTTGTGGCGGGCGGTGTGGCCGGCATGATTGCGCAGTTCTGCGTGTATCCACTGGACACGCTCAAGTTCCGGCTGCAGTG
CGAGACGGTCGCAGGCGGACCGACTGGACGGGCGCTGCTGATCCAGACGGCACGGCGAATGCTGGACGCGAACTCGCCGA
CAAACGGCGGCAGTGGACGGCGTGGCGGCTGGCGGGCAGCGTATCGTGGCGTGACCATGGGCCTGATCGGCATGTTTCCT
TACAGCGCCATCGACATGGGCACGTTCGAGCTGCTCAAAGGCGCCGTCGTACGCTACAAGGCACGGCGTGACGGACTGCA
CGAGGACGACGTGGCGCCTGGCAACGTGGTGACTGGCATCATCGGGGCCACATCCGGGGCTTTTGGCGCGTCTGTCGTCT
ATCCGCTCAACGTGCTGCGCACACGGCTGCAGACCCAGGGCACCGCTCTTCACCCGCCCACCTACACTGGCATCTGGGAC
GTGGCCTCGCGCACGATCGCCAACGAGGGCTGGCGTGGTCTCTACAAGGGCCTCACGCCCAACCTGCTCAAGGTGGCCCC
CGCCCTCAGCATTACCTGGATGGTCTACGAGAACTCCAAGACCCTGCTCGGACTGCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62