GenePrediction:GLEAN_75 Details

Name: GLEAN_75
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:482670..485592 (+ strand)
Length: 2923
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:482670..482822 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_179:482888..483206 (+ strand)
Length: 319
Type: CDS
Source: GLEAN
Position: GCSC_179:483275..483612 (+ strand)
Length: 338
Type: CDS
Source: GLEAN
Position: GCSC_179:483674..484578 (+ strand)
Length: 905
Type: CDS
Source: GLEAN
Position: GCSC_179:484647..484754 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_179:484836..485049 (+ strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_179:485209..485592 (+ strand)
Length: 384
>GLEAN_75 class=GenePrediction position=GCSC_179:482670..485592 (+ strand)
ATGGCCGTGCCGTCGGATGTCGTCGGCCAGGCTCTGGTCGGCTTCTCTCTCAATGGCCTCTTCCCAGAAGACGATGTCTC
CTCCATTGCGCTCACGCCGGAGAGGCTTCCAGCAGCGATCCAGGTCCTGACCGAGGCCAAGGCCAAACTCGAGGTTCGCT
TGGTGATCCATGAATCACATCGATCGCATCGGCTGCTAACTAGGCTGCGCTTTTGCAGGGCGAAATTCACGAAATCGTCC
AAGAGACTGCCGACGACCTCCGTTCCTGGGTCACCAATGCCAAGGCGCTCCAGGTCGACATTGCACGCCGCAAACTACTC
GCAGGCGACATTCTCATTCGCGCCGATGCGCCCAAGACAGACGAGCAAGCCATTGAGGAGGCCGAGGCCAGGGCGCTCTT
CCTGACCAACGAACTCAACTACAATCTGCAGGTCCGATATTTGCTTGAGGCCATCCGCAGCGTGAACCAGCTGCTGGACC
AGGTTGAGCAGGCGGCCGAAGAGCGCCGCATCCTGGATGCGCTACACCTGTTGGAGAGTACGACTAAACCGAGAGCCTTC
CTGGATGGGTGCGTTCCTGTGGGCTAGTTAACTGATGCTTCTCAGAATCATGGACTGCGCTGGACGCCATGCCTGTTAGC
AAGACGTGTCGCGCCATGCGGCTACTGGATCTGCGGGCCTTTGAGCTCAAGTCGGACGTCCACAAGGTGTTCGACCACGT
CTGGGGCGCCTTGGTGCACGTCGATGCGGAGAACGGCACGCTGACCGTTCTCGAAACGCGACAAGACGAACCTATGAGCC
TCTCGAACGCGGTCATCGGACTGATGGCTTACAAGGAGGTCGACGGCCGCATGACGCAGCTCTGGCACGAGCTGGACAAG
GCTGTTGTTGCGCCACGAACCGACCTGTCGACGTCTTCACGGCCAGGTATCTATGTTGATGACGTAAGCCATATGGTTTG
CCACCTGGAAATACAATGAGACTACTGACAGCGCATGAGAGCAGGTTGCACTGGGAATTCGAGGACAGGCAGGCGAGGGT
ATCGAGGCGTTATTTACGGACTTGGATCAGATATTCGCCTTCCTCGCACTCAGGCTGCCGTCTGACCTGGTTCAGTCCAT
CTCCTCGGTGATGATGCCAGAGTTGGTGTCGCGCATCGTGGATGTCTGGCTGGCGTCTGCAGTACCGACATCACTCGACA
AGATGGCTGCTTTTGAGGACACGATCCGAGCGGCTGAGGCGTTTTGCTCGCGTCTTGCGAAGCTTCAGTACTCCGGCTTT
GGAAGGCTTCAGGAATGGATCGAGAACGCGCCCCGTGTTTGGCTGTCAAAACGAAGAGAGACCGCTCTGGACTCGGTGCG
CAAAAAGATTGCCGGGGGGCTCGGCACACCTCACGAGGTGGAGAGGGTGGAGAAGCAGATGGTGTCGCGATCGGAAGGTA
AGGAGCTGGCAGCAAACGGGCCCTCTACGGCGACAGACCAAGCGGCCGACTGGGACGCGGCATGGACGGACGACGAAGAA
GAAACACAGGATTCAGAGCCGAAGACGCAGGCAGGCAGCTCCGCGGACGACGGGGCCGATGCATGGGGTGCCTGGGGTGA
TGACGATGAGGCTGTCGAGGCTCCCGAAGCCGACGCAGCTCCCGAGTTAGAGACAGAGACACACGATGATGAAGACGATG
CAGCCGATGCGTGGGGCTGGGGTGAGGAGGACACCAATGTGGAGGAAACGGAGGTGCAGCAGCAGCCAGCAGTGGCCGAA
CAGATGTCGGCAGCGACAACGGCAGCGACAGAACCGACAACACGGGAATTGATCATGAAGGAAAAGTATCACATAACAGC
CATGCCGGAACCAGTGCTGGCCATGATCACATCGATCCTAGAGGACGGGGCTGTGCTGCTGTCCGAAGGGTAAGAACTGG
ACCTCTCGCGAGCGTTGTTTGGGAGTGTTGTCTGACAAGGGACAGATATGAGAACAGTCCTGTTGCAACGGCTGCAGCCG
GTCTCTTCAGCCTTCCGACCATGGCGCTGGCCATGTTCCGAGCCGTCTCGCCCTTCTACTATGCCCTGGACGTGGGTGGA
AGCATGTGAGTGGAGATGTATATGGACGGGGAGCCGTGGCACACCAAAGAGTGGCAATGTTAACGAGACCTCCCTCTCCC
TCACAGGTACCTATACAACGACGCGATGTATCTGGCGGAGAAGCTGGGCGAGCTGGCGACGGCGTGGAAGATGCGGCCGG
ACCTGGACGGACGAGCGCAGGCGATGCTGCGGCTGGACGGCGAGGTGGCCAAGCTGCAGGCGTTTGCGAGCCGGGCGTAC
GGGCGGGAGCTTGCGATCCAGAAGACAGTGCTGCGGGATCTGCTGGGCGGCGATCAGAACGTGTTGGCGCAGCAGCAGCA
GCGACGGCGACGAAGCGGCGGTGACGACGGGGACGGAGACGACGAGGAGCCGGCCGACCACGTCGACGCGGCCGTGGCGC
GGGTACGGTCGATGGCAGCAGCCTGGAACGGCATCCTGGCGCCGTCCGTCTGGTTCCAGGCTGTGGCTGCTCTCGTCGAG
GCCGTGGCGGCCAAGCTGATCGCGGACGTGCTGGACATGACGGCCATCAGCCAGGACGAGGCCTTTAGCCTGGCCAGCCT
GATGGCCCGGGTGACCGAGTTGGACGACCTCTTTGGGGGCGAGCCCACATCCACCCCCCTCACGGCTCAATACGTCCCGT
CGTGGCTTCGGATGCAGTACCTGTCCGAGGTCCTGCAGTCAAACCTGCCCGAGGTCCGCTACCTCTGGATGGACAGCGAG
CTCAGCCTGTACTTCTCGGCCGACGAGGTCGTCGACCTGGTCCGGCTCAGCTTCGAGGACAACGCCAAGGCGCGCGAGGT
GGTGCGCGAGATTGCGCAGAACCCGCATCCGGTGGAGGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62