GenePrediction:GLEAN_7608 Details

Name: GLEAN_7608
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1070588..1064183 (- strand)
Length: 6406
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1070588..1070395 (- strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_140:1070320..1070067 (- strand)
Length: 254
Type: CDS
Source: GLEAN
Position: GCSC_140:1069736..1069240 (- strand)
Length: 497
Type: CDS
Source: GLEAN
Position: GCSC_140:1068396..1065258 (- strand)
Length: 3139
Type: CDS
Source: GLEAN
Position: GCSC_140:1065193..1065057 (- strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_140:1064896..1064659 (- strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_140:1064607..1064183 (- strand)
Length: 425
>GLEAN_7608 class=GenePrediction position=GCSC_140:1070588..1064183 (- strand)
ATGTCTGAAGCAGACGTCGAGGGGCAAGAATCAGCCGAGAAGGAAGGCGAAGCCACCAGAGAAAGTGTTGGCATCACAGG
CATCACAAGTGTTGATATCGCAGACCCTTCTGTAGCTCAACAACAAAAATCGCCAGACGAAGCTGGGAAGGAAAGGGAGG
CTATGATGCGAGCTCTGAATCAAGGAGACGCCTTGTGAGTTTCTATGTCGCTGAGCATATGCCTGTCTACTCTCCTTGCT
TTGTTTCGAACTGACAGATTTTTGAAAGGCTCTGGAACAATCCTATTGGCTGGGACGTGGTGGTCATCTGTGGCTTCTTC
TCGTGGCGCTTGCACCGACAAATCCTCGACCGCTGCGAATACTTTTCTCCTCGCATAGAGCCATGGAAGTCACGTGAAGG
AGACAAGGTGATTAGCTATTTCGGGTTGGAGGCGTTGCCAAGTCGCTGTCTACATATAATGGAACTACACAATCACGACC
CGGGGCAGCTTGCCAATGTCCTGCGCTTCCTATACACCCATGGTAGGCCATAACTCCCAGATATACCGATCCTGGCTTTC
AGTTGTTGCTTACTGATAATTCAGAATACCCTGGCGCTGTTTACTGTATCTCCGAGCCTCTATATGCTGACTGCCTTCTC
ACGAACACTGCGATGTTCATTACTGCCGCTTCAGTCGCATGCAGTCCCATGATGGACTATGCTGGTGCTGCCATCACTCG
CTACACATCCTTCCTACAGATGTATCTGACCCCGGCCGTTTTTTGCGACTCTCCAAGCATTGACTATTCCGTTTTGAAGC
TCGCCATTCCCTTGCGCAAGGGCTCTGACGATACTATACGAACAACCATCAGCGTTGCTAGCACGGGGCAGATACCACAG
CGGAGACCACAGCAGAGTGGAGGACGAAGACCTCTGCAAAGAAGTAGATGGGATTTTGTGGCCGCTCCGCCAAATTCTCA
TAAAGTTCGTTGCCGTCACACTGCCCCAATTGGCACTGAATCCAGCCTTCCATGCCCAATTTAGGAGTGAGTGGGATGGC
CAGATGTTTGTGCAGCAGCTAGAGGCAGATTTGGCCGACTTTGCAAGGGATGAGGTGGCGCAAAGCAAGGGAAAGGGAAA
AGAGGGGCAGACATGTCTATCACGAGCATACACAGCCCTGTCGCTATTGCACCGGCTGGCTAGGACTGAGCGGGAGTGGA
TTGCGGACGTGCTAAAGCATTGCGACAGGACAAGGGCTGACGAGGACGAGGACGAAAACGGATACGACCACGATTTTGAG
GATGAGAACTGCAGCGAGGACCGCGATCACGGCATAAAACAGCGAGACTTGGCTTCAGGAGAAACAGAGGTTGTACAGAC
TATGCGGCAACCGGAGAATGAAGGCACATAATAAATGCGCTGTAAGCATCCTCTGCTTCCTACGGAAAAAGAGCGCAGAC
ATGGATGTTTTTCCCAATAAACTTGCACGTTCCCTGAGACTGTTGCAAAATAGCACTGACCGATGCCTCCTTCTATAACT
TCCCATTCCTTTTCCGGATCTCTTCTCTTTGTTCTAGATCAATATATTTGGTTGCAGTTACACGTACGCAACCATCTGTT
GACCCACGCTCCATATTGCGGATGTTGGTTTCCTTTGTTCTGTCTCATCACTTGATCTTAATCTCCAAACGGACGAAAAC
AGCAAGAGTTATTGCGAGGTTGGTGTTACCCAAGCATGTAATTTCTCTCTTTTTGATAGCTTAATTTCTGTCCCGCGTGT
AGGAGCCGAAAGATGCCATTTCCGGAAGGGGCCATTGAACAAAAAGGCCTTTCCCTGGCAAGGCAGAAAATAAAATTTCA
GTCACTTCCTTCATGGACATCATACTGAAGCTTGCAATACAGCTACAGGTCCGAATTACAAAAACAAAAACCCCCGCATC
AAGTTACGAATCGGAATACTGCCAAACACGTTACTTAAAACGTAGAAATGTCAACCAACGCACGTCTTGAGAGAAAATAT
GCTGGCAAGAAGAGACCTCGGAAAGGAGTGGCTGTACCAGCAACTCCCTCAATATCTCGCCTACTACCTGCGAAGCTGTC
CACTCCACTGCGCTCCCGACGCAACCGTTTGGGCTTATACTCATCAAGAAGACATCCAGTCATCGACGCTGACCAGAAAA
CGACACCTCCCACTTTTTGTCAATCCAACCAGGACGCACCATACGAAGATGGGATCGAGCAAGAACAGCACGATTCCAAA
AGCAGACAGAAGGGAGACACCGCACATGATGAGACCAAGGTTTACGCCAGAGTTTGCGCGGACAAGCTGAAATGGGATCA
AAGCCCGCTCCAGGCGGACACCGAAGACTGCCAGGAGGACCACTATTTCAACGGCATGCGGCTTCCACCAGTAGGTGATA
GTCTGAAGGAGGTTGTTGCATATTTGTCTCAGCAAAATGTCTACAAGGATGAGGATTGGCCTGTACGAGTCAAATTTATC
GAGGCACACCTGGACTTCCTGGAGGAGGTACCACTCGGAGATGGGGACAGCACACAGGCCGACCAGTGTCAAGCCGATGG
TCCGGACCGTCTGCTCCCACTGCCACCTCCGCAGGCAAATCGCCAACCGCCGGTGTACGGCCAGAATACACGTATGCTAG
TACAGGAGGCAAGACGTCTGGTGCGCCTACAGAGACTATTCGAAGCGCATCAGTACAATATAGCCAAGCAGGCCACAGTC
CTACACAGCCCAGCTGCGATATCAACGATGCAGCCACGAGAATTGCAGTTCAGTAGCCTTTTATGTGTCGAAAGAGTGAA
GAGTGATGCTGCGGGTACGGCAATCCCAAGAAGCCAGCAGCTTGCACCAAATGCAGATATTCGCAAGACAACTGATGGCA
GTGCCAACGACATCCTCCGTATTCTAAAGCACTACCCGGATGCGACCAGCTACTACCAGCAGCTTGCTGCAGACGATGGT
CATTTGATGGGCCAGCCAGCCCAACCAGGCGAATCTATCGACACAATTTTGCAGCGGGCGCAGACAGCCGTCGCAGCGGC
CGAGGCCGGAGGTCAGAATCTCGCATACGGGGAAAATGCAGAGTTCTACCAGAGTGTTATTGCTCAACGTGGCTGGGCCA
TATACAGCAGAGATGGCAGCAGCGCTACAGTACACGACGTCAGGCGACTTCCAGATGGCACCATGCTCGGCCAGGATGCA
ACCAGTTATGCGCGCGAGCGCGGAGCCCGCAGGGCGGCACTGCAGCTGGCTTTGGTAGAATTCTCGTCGTCGGAAAATAC
TGCTGCAAGCAACGGCTCGCCATGGTGTCGTGTTGCACTACCGGTACCAGCTCGCAACATCTATAGGCGGACTGCAGCAG
CAGGCGGTTGCTGGCCGTGGGCTACAAAGGCGGAGGTCGGGGCGGGGATGGGAAAATCGACCAGGGCAGCATCACAGCTG
TTGCCGGTGCCGAAGCTTGTGGCAGGCGGGTCTCGGGGGGATACAGAAGAGAAGAACATGCTTCCCGTTATCAGCAAGCA
GACGCATCCGTACACAGCCTACATGGCGGAGTACCGGCGCCACCGGATCAAATGGGTGGAGAAGGCGCGCATGGCAACAG
AGTCTGAAAATCAGGACCAGCCGGACTGGGCGGTGCTGCCTCGGTTTCCCGATGCGTACAGCCTCGGCTACGGTAGTCCC
AGAGGCCTCCCGCGCCGGCCACTGCCTCGACTCATGGAGCAGGATCGCAGGATGTTGGTGCTGCTGCGTTCCATCGCCCG
TCTGCTGGAGCGCGCTTTGGAGGTGGCACCGCGGCCACTTCTTCGCAACGTACGCAAATACACAGCACAGGGCTTGCGTG
GACTGTCGCAGCCGGACAGCGCGCTGCAGCTGCGCAGTTTCTACGACTGGGAGCCGAGGGTGATCACCGGACTCGCCGCT
ATTAGGAGGCTTCGTGTGGCTCGGCCGATCAATGAGGTTGAAGCGCGGTGGCTCAATTTCTTACTGACGGGATCGACCAA
CAGTCGACTGATGCTGCCGCTTCCAGCAGGCCCCGACCTGCGGGAAGCACACGAAAAAGAAGAAGAGGGGCACAGCGAAG
ACCGAGGCGGACAGGCGTTGTACCAGTGCTTTGCACAACGACTTCAGGGGCTCATGGATGATCTCAGCGATATCCGGCTC
TTTCAGACAGTCGACACGGAGGTGCCGATCAAGGTGCTCGTGGACACAATGAACGAGGATGGAGCACCATTCGACGTAAC
AGGAAACGAGCAGCAGCAGCAGCAGCGTGTGCGGTTTTCCTACGGGGACGCCCGGTTCTTCTGCGACCGCCTCCGAAAAG
CCGGCCGCTGCAGGTTCAGCCCATATAAGCCGGGCTCCGGAGAAGGCAACCGTGGCGGTGGCATTGTTCAGCGGCCAAGG
CTGACTCTGCACCCAGAGCACCGCATATGGGCCAAAAATAGAGAACCACCGGGAGGCCAAGAAGGATGGTCGTGGCTGAT
GCGGCCGCACCCCGGGGCTGACGAGCAGGATCCAGATATTGCCATCGGTGCACCCCAACGAGCCCTGGAGGTGGACGACA
CCTGGGCCAAGACGGTGGCAAGCGGACGCACCAAGGAGCCACTGCGAGCCGAGGTGCACGACTTCTTCTGCGGGCTTGCC
TTCCGCTTTGGTCGCACGCTACGACAATTGGAGATGGTGGAGCGTGGCAGATGGGAGGATGCCGCGTGGAAGCAGGCAGA
CAGCGCCAGCGACGACTTGAACGCCACCCAGACCAAGACCGACAAGAAGAACAGAGTAAAGGAGTGCATGAGCGCGTGGC
AGCAGAAATACGAAAATATGACGAGCAAAAACAACGTCAACTGTGGTTTTCCCGACGTTGTGCGAATTGCTGACCCTGAG
GCTACCAAGAGCAGCAGCACCATGCCGGCAAAATATGCACAAGATTTGATAGCCCACAAGCTGCTCGTCGAGGCTGAGCG
TGCTCTGACACCGCTGCCCACAGCGGCTGCTCCACGGCCATCGGGGTCTCTCTGGGACTGGGCGCTGCCACAAGTCTGCG
GATTGGCGCCCCAATTCTTCCACATAGACCGTTGGCCGGTGCACTTGCAGACACCTGCCGTGGAGCAATATTGGACGCAG
CAGAACGACGTGCTGGACCCAGAAGCTGTCTGGGATCCAGCCAGCGAGGATCCAACGCCAGCGAAGTACATGTGGCGACC
GTCGTCGTCGGCCTCGGCCTTTGGGTTTCAGAAGGAGACGAAATATGTCGGACCGGTGGCGTTCCTCCACGGTGAGACAA
AGCTGCAGCAACTTATGGTGATCGACGATATCACCGAACGTGTAGCGACAGGTAAGATTTCGTGTCGTCTTCAGTCCCTT
GCTGAGAGGCTACCATGGCTGACTAACATCGGCAGCCCTCGAAGCCGTGGAAGAACGTGGGATGTGGAGCAAGCTGTCAG
AACGAGTTCCATTCTTTGGACGGCGGCGGGCCCTCGAATCAGTACCGTTGACGTTTGACGACGTGGTCGTGGAGGATACG
CCGCTGCCGAAGGTGCCTGAGTCCAGCATTCCACACAGCGCTGATTGAAAGGGAAGCACACGTGACTGCACACTGTGCAC
AATTCGTTCTGTGCACACGCCACAAAGCCACAAAGCCATACATTCGCGCGCAGAAGTTTTGTGCCTCATTGCATCTCCAA
CGCAAACGGTAGCAAATCAATATCATGGGCTCCTCAGCTTCAAAGGCTACGCGCACCGGTGTTCCGCGTAAATATCCAAC
AAGAGCAGCTGGTGCTTCACTGCCACACGATACACAACGAGCAGCACGGCCAGCACGATCGACACGACCACCAGCTCACC
AGTCGCAGCGGGCTGAACGGCCAGCAACGGATATATCGAACAGCACCTTGCGCCCTGAACGGCGGCAGCCATCCTTTTCC
AAGGACGAAGGTGTGTTCTTATTTGCTGTCTGAGCTTTTTTCCTTTGTGCTGACAAGGCAGTGATACGTGCCGATGGCTC
CGACCCCGATTGGTCAGCCGCCTTTTCCGATCGCCTACGCCAGCTCGGCGCCGTGACGCCCAACCCGACATCGCCGCAGT
CGTCGGCCGGCGGAATAGACTCGACAGCGGCCGCATACGCCATACAGAGGCGGAGTCCAAAAAACACGACGCTGTCGGTC
CTCGAGGCGCGCCGCCGACTACACGATGACCAAGCGGCCGAGCGGACTGCCGACGTGGCAAGCAAAGGCCGTGGCGGTGG
TGGCTCACACAATTTGGGCCGCGAGTTTCTTTCTGCCAGCACGCTGAGGGAAATCCTGGAACTGCGAGCGCAGGGCGTGG
GTGCAGCCGTCATTGAGCAGCGGCTACGGCTCAAGGCAGGCGTCGTCGATCGGCTGGGACGACCGGGCCTGGTGGAGGCG
TCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62