GenePrediction:GLEAN_760 Details

Name: GLEAN_760
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1938967..1940630 (+ strand)
Length: 1664
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1938967..1939139 (+ strand)
Length: 173
Type: CDS
Source: GLEAN
Position: GCSC_97:1939229..1940630 (+ strand)
Length: 1402
>GLEAN_760 class=GenePrediction position=GCSC_97:1938967..1940630 (+ strand)
ATGGAACGTCAGCCTCTGCTGGAGAAGCGCGGCTCCATCGCCGGCACGCTGCCGCCGCTGTCGGTGAACACACATGTGCG
CCGTCGCCGCCGTCGACTGCCGCTGCACCACATCCTGTTGTCGTTGCTGCTGCTGGCGACGGTGCACTTCTGGCTGTGGC
CGCTGTCCTTTGGGTTCGTTTGTGCATGCTTCTCCTTTCCATTTCCTTCTTATGAATCTACGTCTTTTCTTGCGTCACTT
CCTCCCACTCTGACACCCACAGCACTTCCCCTGTCAAGCAGCCGGCCCGTGGCAAGGGCGCCCCCTTGGAAGGGCCTCTC
GAGCTCACCGATCCAAAGTGCCGCATCTACAACATCTACAACATCTACAACAGCAGCGGTCGTGTGTTCCGGCCGCCGCC
GGCAACGTATCCGCTGGTCTTGGGTCCCGGTCACCGGCTGTCCTTGAATCAGGGATCGCGGCGCCGCGACGACCACGAGC
ACAGACATGAACACTGGCGTCAGGTGCACGTCGAGGGTGACATTGTGCTCCGACAGGCTGATGCCGCCCATCCGGACGGG
GCCGTTGTCGTCGAGCTCGTCTACAACGATGAGCGCATCTACTCCGACGTCGTGCTCGGCCATGAAGGCGATCCGAACAA
CCAAGCCTTCACCCTTTTTGTCGACGATGGCTTCTGGGTCGACGAGCTCGACGATCTGGCCACGACACGGGGCTACCCCT
GTGCTCTGGCTCGCGTGACCGTCTGGGTGCCCGAGCGGACTGGTACCCACCTGGACCGCCTCCGCATCGCGTCCACCTAC
CTGGGTATCAAGCTGGTCGAGGGCCTCGACATGACCATGGCCCTGTCTGCACATTTGTACTCGCAGATTTCCGACGTTGT
CGCTGGCGTCCAGCTGTCATCGCCCTCAAACAAGTCTGAGTCGGGCTTCCACTTCGCCGCGAAGAACACCGAGATCGTTC
TGACCGCTGGCAGTGTGGCTGGTGGACCGTGGGCGCTGCGCCACTCGTTGGCCGTCAGCTCCTCGTCGGGGACTGTCGAT
ATTGAGGTGGAGGAGACCGACGAGACCGACGTCTCCGACGTGGCGCCGTACCTGTCACTTTCCACCGTCTCGGGCGACAT
CAAGCTGCGCGAGCTGCCCTCGACGGCCAGCCGGCCCGGCCACTCGCTGTACGTGGAAAGCCGTTCCGGCAGCATATCCG
TGTCCGATGCCGTCTTTGCTCGCATCGCGCGCATCCACACCGTCTCGGGTGACCTGGACGTCAGCCTCCGTCCGCAGGCC
CCGCTCGCCGGCAACAGCACCGCCGAGGAGCACCGCGAACTCGAACTCGAAACCTCCACTGTCAGCGGCCATACTGCTGT
GCAGCTGGCCTACGGCGACGATCAGCCGCCGCTCGACTCTCTTCGCTCCCGTCATCACGCCGTCTCCGGCAACATCAACC
TCTGCTATCCCAACGCCTGGGCCGGATTCGCCCGCCTGGACACCCTCGTCGGCGGAAGCGCCAGGCTGCTCGGCAGGGAC
GTTCACGTGCTGCCTGACGACAACCCGCACTTCCCGCCGTTCGTCGGCCACCACGTCGAGGGCACAAAGGGCAGCGCCGA
CAACGCGTCAACCGTCGAGGCCAAGACCACGACCGGGTCGATCCTGCTGGCATTTCCCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62