GenePrediction:GLEAN_7610 Details

Name: GLEAN_7610
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1039714..1037838 (- strand)
Length: 1877
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1039714..1039333 (- strand)
Length: 382
Type: CDS
Source: GLEAN
Position: GCSC_140:1039276..1039020 (- strand)
Length: 257
Type: CDS
Source: GLEAN
Position: GCSC_140:1038964..1038849 (- strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_140:1038795..1038236 (- strand)
Length: 560
Type: CDS
Source: GLEAN
Position: GCSC_140:1038170..1038082 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_140:1038032..1037838 (- strand)
Length: 195
>GLEAN_7610 class=GenePrediction position=GCSC_140:1039714..1037838 (- strand)
ATGGCAGAAAACAGGACATCCATCGGAACGGGCGGTGGTTGGAGCAGGCCCAGCACGGGCTCAGCAGCCAGCATCGACAG
CAACGGGCCTGTCGCTGGCGAGACGGTCGAGCGGCCGGCTCCGGTGTCGGACATGATGCCGTCCGAGACCAAGGAGACGG
CCGTGGTGGTCGAGACGGAGCCGGTGCCGGCGCCACCCTACAGCATCTACAACGGACGCGAGAAATGGTTCCTCGTGGCC
ATGGTCGCAGTGGCCGGCTTCTACAGCCCGCTGCCGGCCAACATCTACTTCCCAGCCATCCCGCAGATGGCCAAGGCCTT
CCACAAGAGCACCAGCGCGCTCAACCAGACTGTCACGGCTTACCTGGTCATGCAGGGACTCTGTAAGCTAAAGATGAAGC
GGAAGCAGTCGCAGAAGCAGCCACAGCTAACCGAACAGCCCCCATGTTGTGGGGCCCCCTGTCCGACCGCTTCGGTCGCC
GTCCCGTCCTGATGGGCTGCATGGTCGTCCTGCTCGGCTCCTGCATCGGCCTGGCCCTCTGTCCCGTCAGCGCCTTCTGG
CTGCTCATCCTCTTGCGCTGCGTCCAGGCTGCCGGCTGTGCCAGCACAATTGCCCTCGGCGCCGGTGTCGTCGGCGACAT
CTCCACGCCCAAGGAGCGCGGTGGCTTCTTTGGCATGTTCAACATCGGGCCCATGGTATGTCTACCGTCTATCGTCTGCT
GCACTCTACCCTCCACCTGCTGACCGTCAGATTGCCCCGTGCATTGGCCCCGCCATCGGCGGCATCATTGCCGAGAAGCT
CGGCTGGCGTGCCATCTTCTGGACGCTCGTCATTCTGGCCGCCCTCTGTCTCGTCTTTATCCTGTGGTACGTGCTCTCCG
TCTGGCAACAGCGCCATGAATGCAACCCTGACAGGCCAGCTTCCTTCCTGAGACCCTACGGCGACTCGTCGGCAATGGCA
GTGTCCAGCTTGGCGGCATCTACCGGCCGCTCGTTCCCATCGTCGCCCGCAACAGATCTCCATCGCCGCCATCACCGACT
CTTCAGCAGCAGCGCCCCCCGTCTATGAACCCGTTTGTCATCCTGACGTATCCCGACGTCATCGTCAGCCTTGCCTTCAC
TGGCATGGTCTATGCCGTCAACTATACCATCACTGCTACTATCTCGTCGTCCTTTGCCGATCTCTTTCCCTACCTGACCG
AGATCGAGATCGGCCTCTGCTACCTGCCCACCGGCGCCGGCATGATCGCCGGCAGCACGCTGACCGGCAAGCTGCTCGAC
CGTGAGCACGCCCGCTTCAGGCGTGAGACGGACGCTGCCTCCGATGCGTCCGGCGTCGAGGTACCCTTCCCCAAAGAGGT
CGCCCGTCTGCGCCTCATGCCTATCCACCTCGTCATCTTCACCGCCTGCGTCTACTCCTGGGGCTTCTGCCTCCGCTACA
AGGCCCCATTGGCTGTCCTCCTGATCATCCAGGTCGTCCGTAAGTTCGCGAGCGTGCTATGGCAGCAAATCCACTCGTAT
CGACCACCATTGCTAACCAGCCAGTCGGCTACACGTCCATTTCCATCCTCAATACGACCATGACGCTCCTCATCGACATT
CTGCAGACGAGAAGCTCCTCAGCAACGGCTTGCGTATGTTCCTTTCACCCTCTTGCTCACCAGGTCCCATGCTGACCGAC
AGACAAACCTGGTGCGATGCCTGCTGGCCGCTATACTGGTGGCTGTCATTAACAAGATGACCACTTCTCGGCTGGGGCCG
GAGTATACATATGTGTTGTTTGGAGCAATCTGTACTCTGCTCCTGCCTTTGATGTACGTAGAGATGAGGATGGGACCCCG
TTGGAGGCTGAAAAGGGAGTCGAAGGAGATGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62