GenePrediction:GLEAN_7612 Details

Name: GLEAN_7612
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1029094..1027534 (- strand)
Length: 1561
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1029094..1028751 (- strand)
Length: 344
Type: CDS
Source: GLEAN
Position: GCSC_140:1028691..1027689 (- strand)
Length: 1003
Type: CDS
Source: GLEAN
Position: GCSC_140:1027566..1027534 (- strand)
Length: 33
>GLEAN_7612 class=GenePrediction position=GCSC_140:1029094..1027534 (- strand)
ATGAACGTCAATCGGTGCGCCACCTTGCACAACCAGCTGTTCGATATCGGCCAAGCTGGCTTGGGGACGTCTGAGCCTGC
AGTGCGCCAGAACTGGTTTGCCTTTCATGGAGACAAGGCTGAGGCAGTCCGTCATCGGCTCTCGCCGTCCCTCGTGGCCT
TCCTCGAGCAGGCGTGGAAATGTAGTGGGAATGGTCACGCTTTCTTCTACTACGCTTATGGCCTGGCCTATCCCGAATCT
ATGTGGACCACCCACGAGATAGAAGCCAAGGATAGCGACAGTCCCTATCGGTACCTGACCCTCTACACGGCCACGAATTT
AGCGTCCCACCCAGAAGGCGTAGTGTGAGTATCATGCTTTTGGCCTCTGGAATAAGAATGAAATGCTGAGTAATACGGTA
CAGGTTCGACCAGGAGACGAACCCAGCCATCATGCGAATGTCTATCTACGACATGAGCATCACGCAGAACGGTCGCCAGA
AATGGTATCCTCTGGAGGATGTGCTGAATGCCTGGCTGGAAATGATTGACAGTGGCAAGGTACAGGCTGTTCCCGAACAT
GTGGATGTGCCCAACAGCAAATACGACCCGTGGATCCTACATCCATACAGTGAGGGGCAGCTTAAGGAGACCGCCGAGGT
TTTTAACAGCCTGGTCGATGCCATCGAAGCACGATTGCCGCCGACCTTACAGCCACCAGTCTCGGCTGATCGTGCGCCGC
TCCTGTCTGATGCAGCCATGGACGCGGCCAATCTATCCCGCGGTTTTGCGCGTTCGTTTTTTAGCCACGCGCACCAGCCA
CGATTCTGCTTTATTGCCCCGGGTTTAGAGGTGCCTACCGCTGAAACGTTTCCGAACCAGCCGTTTCGGGCATCTGAGGA
CGGCGACGAAGACGATGAAGAAGGCCGAATGACAATACCACCTGTCCTGTTATTCCATTCTGCAATTCCATTTGTTGCTC
CCGCTCCTACGATAAATCGCGGCACAAGAATTGAGCCTCCCTTCAGCTGGCCCTACAGCGTCATGCCAAGCTACCCTTCC
GGACTGTATTTAACCTACACGGATCGAGAAGCTGGCGTAGAATTTGAAGACGGTGCGAAACTGGTGCTTCCTTACAGCAT
TGGTGCTCGTGGATTTGCGCGGACAGCCGATGGAGCCCGCTTCGGAGAGAATAAAGAAGCTCGCGGCACCGTAGTTCAAG
CCCATGACACATTTTCTGATCTGTACCAGCCGGGCTACATCCCATTTGGTGAGCAGCACGACGTGCGGCTTGCCCATGTT
TTGCGGGAATGGCTCAAACAAATAGAGGACAGCCAGTGGTTTGTAGGACCGGAAGGAGTCATCGGAGGGATGGACAAATG
GCGGGAAGCAGACACTGAGAATGGATGGCAGGATTATGTAATCCCAGTAAGCTGGTAAAAGCGAATTCAGTGGGCAAATT
CGAAAAGTACGGAGTAAGACAGCAAGCTTCTTGGTTTTTGTCTTCCTCCTTTTCGCAATACTTTCCCTTTCATTCGATTT
GCTCACAGACACAGGCCATAGAATGGACACGGGAAAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62