GenePrediction:GLEAN_7613 Details

Name: GLEAN_7613
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1023428..1022139 (- strand)
Length: 1290
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1023428..1022955 (- strand)
Length: 474
Type: CDS
Source: GLEAN
Position: GCSC_140:1022882..1022424 (- strand)
Length: 459
Type: CDS
Source: GLEAN
Position: GCSC_140:1022363..1022139 (- strand)
Length: 225
>GLEAN_7613 class=GenePrediction position=GCSC_140:1023428..1022139 (- strand)
ATGTCAAAGTTCCTTCTCCTACTCGTGGCTGTGAGCCAGGCCCGCGAGATCGTCTTTCCACCTGTTGCCGCCATCCGAGG
GCCAGCTGCTCATACACAGTTCCATCTGACTTCCGACGTCGATTTAGACGACGATGTCGACCTGACGACAGATCCCGTCG
GCGGGCTCGCCTCGTTTGCCCACCTGCCGTACGTTCCGTGCTTCTCCTCCAAGACCGACGACGAGGTCGAGAAGTACGAC
ATTGCCGTCCTCGGCGCGCCCTTTGACACGGCTACGTCGTACCGTCCAGGCGCCCGCTTTGGTCCCCACGGCATCCGAGA
TGGCTCCCGGCGCATACGTCCCAATCACTCGTGGAACATCTACTCGGGCCACAACCGGCTAAAGGAGTGGGCCAAGCTGG
TCGACTGCGGCAATGCACCGCTGACCGTGGTCGACAACACCATGGCCCTGAAGCAGCTCGTCAAAGCGCACAAGGTGTGT
GTAGAGAGAGAGAGAGCCTGTTGTCGGCTTCCCGGTCCTCTAAGCCGCTGCTGACTGGTCTGAAAGATTACCTCTGGTCG
CGTAGCCAACAATGCCTCCATTGCCACCATTCCGCGCGTCATGATGCTAGGTGGCGACCACACCATCACCCTGGCCGCTC
TGCGCTCCACCTACGAGTACTGGGGTGTCGTAAGTGTGATCCACTTTGACTCGCACATCGACACCTGGGATCCCACCGCC
TCTGGCGGCGGCATCACCGACTACGCCTCCGTCAACCACGGTACCTTTCTGCACATTGCCCACGAGGAGGGTCTTATCTC
CAATGACTCGTCCATCCACGCCGGTATCCGCGCGCCGCTTGGGACGCAGCATCGCGATCTCAATAACGACGTTCAATGCG
GCTTCGACATTGTCACGGCCCGCGACATTGATGCACTCGGCACGCAGGGTGTCATAGACAAGCTCAAGAATCGCGTTGGT
GACAGCAAGGTCTATATCACCGTCGATATCGATGTCCTAGATCCAGTGCGTGTTGCCTTCCACTTCCTAGTCATCCCCTC
TTAACGACCTCTTGCTGACTAATAGGCCTACGCCCCGGCTACCGGCACGGCCGAGCCAGGCGGCTGGACTACTCGCGAAC
TTCTGACTATCCTCGATGGCCTCATCGGACTAAAGGTCATTGGAGCAGACGTTGTCGAGGTGGCGCCGGCCTACGATAAC
ACAGGCGAGACGACTTGTCTGGCAGCTGCCGAGGTGGCTCGTAGTCTGATTGGGCTCATGGTGGCTGTACCTGTTACTAA
TAAGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62