GenePrediction:GLEAN_7617 Details

Name: GLEAN_7617
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:985195..979798 (- strand)
Length: 5398
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:985195..985066 (- strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_140:985010..984822 (- strand)
Length: 189
Type: CDS
Source: GLEAN
Position: GCSC_140:984760..984718 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_140:984652..984465 (- strand)
Length: 188
Type: CDS
Source: GLEAN
Position: GCSC_140:981826..981080 (- strand)
Length: 747
Type: CDS
Source: GLEAN
Position: GCSC_140:980905..980871 (- strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_140:980805..979798 (- strand)
Length: 1008
>GLEAN_7617 class=GenePrediction position=GCSC_140:985195..979798 (- strand)
ATGATGGGATCCCAACTCCCCCACGGCATTGCATCTGTGGTCGCTGGTGTGCTGTTTTACAGCTTCATCAACTTGTTCGC
CGTTCTTGTTGTCATCTGGTTGACATGGGGACATAACGAAAGACTGACTTGTACTGTCCACCCATGCTTTCTCATTCTTT
CTGGCACTTGATCTGACTCTTCTAGACGTTGCTTGCCTATCGTACCTCGTCTGTCTTGCCATTGTCGCATCAATAATACA
GCAATTTCACGACGCACTGTACTGGAAAGATGTCGTCGAGACGCAGTTTAAGAACTTGAAGCTACACCCGGACAATTCAC
AGCTGGTTATCGCCAACAGTCCGGCTGGTCTCGACCTGGGACTGTTTTACATCCGTGCGATATGTCTGCTTTCCAAAAAC
GGAGTCGTGCCCTGAGCTAATTATTGTTGTTACAGAATTCTATGTGTATAACTCAGCGTCCCTCTTGGCCATGTCTTGGT
ACGTCACTTTGTGTGGCGTTATAGGTGTCTGCTTGAATTACGTGGGTGCTAACGTATCGCCAGGTCGATTCAGCTATCGC
AAAAAGTGTTTGGCCTGGCAAAAAGCGAACGTTCGAGGCGGGCATTCAGCCAGATTGACCACTTTGGAAAGGCCTTCGCG
CTTGCCTTTCCCATCATTACAATCTCATGTCTCAGTGTGAAGGCCGTCAAAAAAAATCGTATAGGTTTCATCATATTGGC
CGACATCCCTAGTAAGCCCGCAGTAGGTAGGGCTGAGCGAGATAGACAGAAAGCAAAACTGACAGAGCGCCAGTGATGAT
GGGCCTAACTACTTGCTGCGTTCTATTACTCTCCATCATCGTCAAGTACATCAAATCTCGACGGCAATTTCTCGTCTGGA
GCAGTAGTCATGAAGACCCAAAGTTGGGGTCTCACGGCTGCACCACATCGGGTGAAAGCAGCCCGGCCGAACGTCCACAG
ACGAAGCAGATCTACGACCGGTGGCTGCTCGTTCGCTTTTCAGTTACGTTTGTGATGCTCATGTGAGAGACCCTCAGCTC
CGTCACAAGCCGTCAATCTTTTATAACTGACCTGAGAAGGGTACTCCAGGTCGCCAATATTATCTTCCAGGTCACTTCAA
TCCAACACAGCAAAAAAGATGCAACAGCCACGAAGCCTGATTTGAGCAGCAGCCACGCTCGATCCATCTTCATTCTCTTC
ATGCCAGGGGTCTCGCCTGGTTTGCTGTTGTTCATTGTGTTCGGCTTAGCGAAAACATACCGAGAACACATTTACATGTT
GGTGGTGCCAAAGCGGTGGCAGCGTCCGTTGTCGGACCCAGAGGAAGCTCTGCAGAGCACCTCACAGACTGGCTCGCTTC
CAATACAACAGCGGGCCGATGATAGTGTGGCTACCTTAAATGGAATATACACGCCAGGAAAGGATATCTTGCTGGAGAGC
TCACTTGAGGTGATCAGCTTGCATGTACTGAGCGAAGGAGGCACTGATGGGCCCAATGACAAGCTGCGACTGCTTCTTTG
ACAATAAAATCTCTAATAGACTGTATTATGAGCCCTTACAAATATATTTCGGCCTAGCCGACCTCGTTGCCGTGAGTTGT
GTTCTGAAAAAGGGGGACACAGATTGATGCATGTAGTGTAACTTTGGCGTAGATTTTACTGAAATTTTATTCTACGTTTC
TAACTATCACTTCATAATGGACCAAGTAAAAGCAATGCGCCATTGCTTAACGACAGGCATACATACTGCAAACAACACGA
GGATGAGTAACTATGGAGAGTCCTACCCCTTTAAAGAATATATCGCATCTCTTAGTAACAACCTCCATGGAGCTAGATTC
TTATACGCGAAGTTATGGTAAACTGAGTTGTCACATAATGGCTCATATCGACGATAATTGGGGATCATACTTCTATCAAT
AATCGACAGAAACATCGCAATTTCGAAGTTTCAACCGGGAAAGATCTCAACGGGGAAAGATTAATTAACGTTGTGTAATA
CTGTCTGATCACCGGTTTGATTGCTCTCTACTCCGTACTTGGCAGGCACGAGCAAGGAAGCTTACGAACATGCAGTACGA
GTAAATCGGTTGTTTCTTTCCCTTTCTGATATGAAAACTCAAGCTTATTTCCCCCCCCCCCCCCAAAAAAAAAAAAAATG
CAATCGTCGCTTGCACACAGTTCCCAAACTCCATTTGATCCCGTCTCATAAAAAAGCCATTATCATGTCATCGCCGATAG
CACCAAGCCTGCCAACAAGAAGACGAACGCAACCAGTCAGTCAAGCTCAGCTTAAGGGCAATCCGCCAGGTAAAGCCATA
TTTCCTTCTTCTATGGTCAACGCCCAAACCGAGCTGAACTCCGAACGACGTGTCTCGACCAAGTTGACCACCAACTTGGA
AGTTTGAGAGGAGGAATTGGGATTGAACTTGGAGCAGGAATTGGAGTCGAGGTAAGTCTCAGGCAATGCGACTAAGCTTT
ATGGCAACGTTTCGCTAGTTCTACCTTGGGCTTTCGTACGTTACGTTAGTCGTTTTGTGCTAATATTCTGCTCCATACTC
TGGATCGCTCCGTATTTATGATAGGGCCCCCGCTATAGTTTATCGGAAATTGGCGGCTCTACTCTGTACAGAGTATGTAT
CTTACCACTATATGGGGAGAGCATCTAACAAGTAGAAAAACAATTCGTGCCTACTCCGTATACCTTGTTATAACCCCGGT
ACTCCGTACTTTCCGAGAACACCATGCTAACAGACATCCTATCGTTGTCTCCACCCCATTTGGTACGTCGTATTCTACAC
ATAAGTTGCTCAAGTCGTCTACACGTGAAAGGATGAAAGGCGATGATCGCGCAACGTTGCTAAGACAAGAAAGTTGCGTA
GGTGTAAGCTGTAAATAATGCAATAGTATATATAAACGTTCCTGTACCAGGGCAGACAAGAGCGGGCTCGATATAGGCCT
ACTCAACACGCCGCTCTATCTAGAAGATACGCTGCACAATGAAAAGCTTGGCGGCGCTGGTTTGTGGCCTTATCGGTTTG
TGTGCTATACAACCACATATCAGCCGCCCAACTGCTAATCGATCTCACAGGCCTGGTTTCTGCCAGTACCTTTCTGCCGG
GAATACCCACTGTCCCTTTTCAAAAGCAAAATGGGAGCTTTAGTCTCAGCCACGTCAGACAAATCGTTGTAGATTGGCGA
TATGCTTCTTCGGTTAATGAAGCTGGAGAGACTCTGATACCGCCAACGTTGTTTGCATTTGCTTCAATATTTGCGAATGA
TTTGGAGCCAACACTTGGCATATCAGCACAAACAACTTTAGGATCAAGCTTCTCTGCTACAGGCAACATTTTCCTAACAC
TCGATTCAGAGGGCGAGTACCTTGACGCGACCGGGAAACAAAGCTCCGAGGCTTACAAACTTATCACCAGCCCATCCGGT
ATCACCATCATCGGCGCATCACCGCTTGGCGTTTGGTGGGGAACACGGACCATCCTCCAGCAAGCACTACTCTCGCTTGC
CGAGTCGGGCGTGCCATCCATTCCGTATGGGTCCGGTCTCGACATCCCCGGATGGGCCATACGCGGAATGATGCTCGACG
AGGGCCGGCACTATCATCCACCCGAGTTCATTATCGAGCTGTGTAGCTACATGTCCTTCTTTAAACAGAACACTCTTCAA
CTGCATCTGAGCGACAACTTGTACCACAATCCGAACTACACAGAAGAGCAATCAAACGAACTGTACGCGCGATTCCGGTT
ATGGAGTGAGGAATCTGCTGTGGCAGGGCTCAATCTTCATGCGAATGAATCCTACGATCGAGCAACTTTCGATACCATCC
AGACAAAGTGTGCATCGCGCGGTGTGACCGTCATCCCGGAGATCGAGGCTCCCGGGCATGCTCTTGTGATTACTCAATGG
AAGCCCGAGCTTGGCCTAGACACAGACTCCAGTCAGTTGAATATCTCGCACCCAGAGGCTATCCCGACCATGAAGACTAT
CTGGGAGACCTTCCTCCCATGGTTCCACCTGAAGACTGTTTCTATCGGCGCGGACGAATACAAAGGCCCCGAGGCTGCCT
ACAACAACTTTGTAAACTCCATGGACGGATTTATTGGTACAAACGGCAACAAATCTATCCGTATATGGGGAACATTCCCA
CCGATCTGGTATGTTTGACACGAAAGCAGTTAAGTAAAGGCGTTCCAGTGCTAACTTCTTTATAGTAAGTCGAATTATGT
GGTAGGAAGTACTGCAAGCTTGCGGGCTGTGTGCTAACGTATCGCATCAGACAACTCGACCTGGACAAACGTATACCAGA
ACGTGGTACGCGCATTTGCATAGCAAAGCAAGTTGCCCATTGTGATATGCGCTAATCTGAAAAATCACAGTCTGTACAAC
ATTGGTACTACGGCGCAGATAATCCTTACACCGACTACATCCTAAACAACTACTCCGTGGTCAATTCGAACGACGATTTC
TACGTTGTGAACAAATGGTCACACCCAGGAGGCTACCCCAACGCTGTCAATTTAACAAGGACTTTTCACGGCTCTCCAGA
CGGCACCTACTGGAGGCCCAACATTTTTGACCAGAAGAATGCATCGGATAACCCAGTTTTGTCAAGCCCATATGTACTGG
GCTCTATCGTGCCGTTATGGAACGATTACGGGGCTAACGCATCCGTGTATTCCGAGGCTTACTATGCCTGGCGTGAGGGC
ATTCCCGCACTTGCTGACAAACAATGGGGAGGGAACGTGAGCGAGGCAAACTTTACGGGTCTCTTTGCCGCATTGCAGCC
CAAAACGCCTGGGCAAAATCTGGAGCGCACAATTCCCTCCAAGTCTGATACGATCTTCAACTACGAGCTCGATGGCCTTC
GAAACTCGAGCTTCATCCCCGACAGTTCCCCTAACAATTACACAGCTCATACAACCTGTACTGTTGGCAAAGACGGTTCG
ATGACAGCACTTGCTGTCTCGGAAAGCCGCAGTGTCACAACTCCGCTAGACTCCAAGGGTCGCAACTACACCTTGTCACT
ATCGCTACGTGTTGATTCGCTGACAGACCCGACCAATGCAACGCTCTTAACTGGACGAGATTCCATCCTCATGCTTACGC
CGAACATCACTCTGTTTGCCGGTGGTAACTACTTTCGTCTGAATGCTACGGTACCCCAGGGTGAATGGTTTCGACTGGAT
TTGGTCGGGCGTGGAAACCGTACGTTTGCAGCTCTGAACGGTGGCGCAGAAATGCAATTCCTCACGATTATGGGCATAAA
TGGGGTGTATCACCACTGGGCTGAAATCGCCATCGAAGCACCGCTGAGAAAACTGGGGGGCTCAAACTGCAACTGGACCG
GGCTGTTCGGTGGGATGTCTTTGAAGTCGACAGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62