GenePrediction:GLEAN_7618 Details

Name: GLEAN_7618
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:963397..959468 (- strand)
Length: 3930
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:963397..963298 (- strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_140:963220..962767 (- strand)
Length: 454
Type: CDS
Source: GLEAN
Position: GCSC_140:962434..961991 (- strand)
Length: 444
Type: CDS
Source: GLEAN
Position: GCSC_140:961921..961811 (- strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_140:961411..961197 (- strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_140:961129..959836 (- strand)
Length: 1294
Type: CDS
Source: GLEAN
Position: GCSC_140:959750..959468 (- strand)
Length: 283
>GLEAN_7618 class=GenePrediction position=GCSC_140:963397..959468 (- strand)
ATGGCTTCGTCGAGCTCGACAAGCGGCCCATCGGGCGAAATGTATTCGGGCGGCGGCAGTGGCTTCATCACGGGGCTGAC
GGAGAAGAAGGTGACCCGAGGTAGGTGGGCAAGACAGTTTCACGGATGGTCGGGTTGCATGAGCGCTGACCGGCCGTCTC
CTCTCGGCTCACCGCAGACGGACAGCCGGCAAAACGTCGTGGGCCCAAGCCGGATAGCCGGCCGGCACTGACGCGGCGCC
AGGAACTAAATCGACAGGCGCAGCGGACGCATCGCGAGCGCAAGGAGCTGTACATCAAGGCGCTCGAGGACGAGGTGCTG
CGGCTCAAGGAGATTTACACAAACGTGGCGCAGGACAAGGAGCGGCTGGCGGAGGAGAACCGGCAGCTCCGGCAGATGCT
CTCGCAAGGCGGCAGCACAACGGCTGACGATGCGACCAGCAACCCTACGAGCGGTGGCCTCTCGGTCAGCGCGTCGGGGA
GCTACGTGCAGGCGCCCAGCTCCAACACCAGCGCCTTCACGCCGCCGCCGGTCTCGGTCTCGCCTCACCTCGGCGGAAGC
TTCCAGCAGCAGCAGCAGGGCCGCAATCCCGGCATTGACTACGAGCAGGCTGGCATTGACTTTGTCTTAACGTAGGAGAC
CATCCCTCTTTGGCTGTCGTCCTCTTACCTTCTTCCTCCCTTTCAGTCCTCTCTCCTTCCTCTTTCCTTCTCTCCCTTCT
CTCCCTTCTCTCTTCTTCTCCCTCTCCATATCGTCTCCCCTGTCTCTTCTGTCTCCTCTGCGCCCTGCCTCGTCTCCTCT
CGGTGTCTTTTGCAAATTCTCTCCAATTTGGACCGACAAACCACGTGGCAACTCTAAACGCGTCGCCGTACTTTTCATGC
CCACTCCCGCTAGAAATGAAAGAACAAAAGGCCTAAGAAGAGCGGCAGAGGAGCGTGGAAGGAACAGCGAGAAAGGAAAA
AAGAGACGTTGCGCTGGTGCTAACGGGCGACCCCCTGCCCCTTTTTGGCCTCTCGCCCAAGGAGAATAGTCTTGAGAAGC
CGTGCATGGCCCACATACCATTTCTGCTTGAGCGGAGCGTCGAGATGGACGGGACGCCGTGCGGACACGCACTGATGGCA
TCGTGCCCGCCCGAGACGCCGGCAAACATGACGCCGGACATACCGTTTGGGTCCAGCAACGTGCCGGTCGACGTTGGCGA
CGCCGCGTCGGGGCAGCGCACGTGGGATCTCAGCAAGGGCGACCTGGCAACGCTGCTGCACCTCAGCAGCAAGCTGAACC
TGGACGGCGAGATCACGCCGGTGATGGCGTGGGGCATGATCCTGGCCCACCCGCGGCTGGGCGAGCTGACGCCGGCCGAC
TTTCAAAAGGTCACCGAGGAGATGAGTGACAGGGTCCGCTGCTATGGGTGAGAAGCTTGCCTTGTCTATCTGCTGGTCTC
TTGCAGTCATTTAACTCATGAATCTCTTCGCTCTAGATTCGGCGCCGTCATGGAGGACTTTGAGGCCCGGGATGCGATTG
AGAACCTCTTCTCGACCAAGCCGGATCTCTACTCGCCCGTGTCGAACCCGGGATTCGCCATGGCTTTGTAAGGATTGGCC
GGAAGAAGGTTGCTGCGGATGTACGGCCTGCCGTGACTGCTGAGGCTGAGTGGCGAGAGGCGGAAGGCGGATTGATTTGG
GGATGGATCTTGGTGTGGGTGACGCATCTTACCTGTGTTTACAAGTTTACCTTTTTTCCAGCATTGCATTGAAATACAGA
CAGCGACATGTTCTCTGTTTGACTCACCATCTCATTCAGCATGCCAATGACTCAACCACCAGCTGGTGGCAGCTGTCAGA
GGGCCCCACTGTAATACCCCGCCTCCCACAAACGGTCAGCATTTTTTTCTAGCAAAATAATGTGCAGCCCGAATTTTCGT
AGGCCGTTCGAGAGCCTCTTTTTTCTCCTTTTCCGTTTTTTTCGTTTTTCCCGATCAGAGGACCAGCACGATGACGGACT
CGCTCGCCAACATCATTTCGGCGCTGCCGGACGGCGACGGCTGGGGCCCGCCGGTGACGACGGAGACGACGCTGAACGGC
GTGCCCTACGCGCCTTTCTCCAAGGGCGACAAGCTGGGCCGGATGGCCGACTGGACGGTCGACAGCAAGGACGGACGCGA
CGGGCGGGGCGGACGGTCGCAGTACAACCGCTACGGACGAGGTGAGCCGGGGGGCTGTGGCAGCGGAGCGGCAGACAGAC
GGCCAGAGGCATGCTGACGGGCGAACAGAGCAGCAAGTGTATGGCGCAGGCTCGGTGGCGCTGTTTGCGGCGCCGCTGGC
AGAAGACGAGGCGAGCTTCTCGGTGGTCAGCAACGCACGCGACACGGTCAAGACGCGGTACGGACGGGGGGCGGTGTTCA
CGCGGGGTGGCCGGGGACAGCAGAGAGGCGGCCGGGGCGACAGCCGGGGAGGCAGCGGGCCTCGAGGCGGGATGCAGCAG
CGGGGCGGCGCCGGAGGACGGCAAGGCGGACAGTACGGTGGCGGACAAGGCGGCGGGTACAACGACCGGGGCGGACAGCG
CGGTGGCGGTGGCGGTGCGCGTGGACGGCGGTTTGGGTGGAAGGACTACGACAAGCCAGCACGAATTCGCGATGCCTCGA
TCAACATTCGGGCCGACTGGAAGCTGCTGGAGGAGATCGACTTCAACCGGCTCGGCAAGCTCAACCTGGACGCGGATGCG
GGCGAAGACCTGGACTCGTGCGGCTTCTTGTACTACTACGACCGCGCATACGACAAGCCGGCTGTGGCGGCTGTGGGCGC
TGGCAAGGCTGGCGAGCGGCGGCTGACAGCACTCGATCGCGCAGCCTACAACGTCACGACGTCGTCGGACCCCGTCATCC
AGGAGCTGGCCGAGCGCGGCGAGGCCACCATCTACGCCACCGACAGCGTGCTGTCAATGCTGATGTGCGCTCCTCGGTCC
GTCTACTCGTGGGACATTGTGATTGTGCGCCAGGGCAACAAGATCTTCCTCGACAAGCGCGACAGCGCAGCCCTCGACAT
GGTCACGGTCAATGAGAACGCGGTCGACTCGCCCATGGACGCGGCCGATGGCAGCAAGGACACCGTCAACCAGCCGGGCG
CCCTCGCTGAAGAGGCCACCTACATCAACCACAACTTTGCCACCCAGGTCGTGCTCGAGGGCGGCGCCAAGGTCCGCATG
GCCCACGCGAATCCCTTTTATAACGCGGCCGAAGAGACGGAGCCGCCGGCCAGCAAGGCGTACAAGTACCGCCGCTTCGA
TCTGTCCACCAACGACGAGGACCCCGTCTACCTGGTCGTCCGCACCGAGCTCGACGCTGTCCAGAAGAACGCCACCACCG
GTGAGGACCAGTTCCTGTCCATCAAGGCCCTCAACGAGTTCGACAGCAAGGCTCAGGGCTCTGGCGGCGCTCTCGACTGG
CGCACCAAGCTTGTCAGTCAGCGCGGTGCTGTCGTCGCTACCGAAATGAAGAACAACTCCTGCAAGCTGGCCCGTTGGAC
CGTCCAGAGCATTTTGGCCCAGGCCGACATTATGAAGATTGGGTGAGTTTTTGTTTCTCTTTCCTTTTTCTTCTTCTTTC
CTTCATCTCTTCTCTCTTCTCCCCCCTTCACTGACTAACACTCCCAGCTTCGTCTCTCGTGCAAACCCAAAGGTCAACGA
CAAGCACGTCATTCTTGGTGTCGTCGGCTGGAAGCCCCGCGACTTCGCCTCCCAGATGAACCTCTCGCTGTCCAACGGCT
GGGGCATCGTCCGCACCATCGCCGACATGTGCCTCAAGAAGGAAGACGGTCGCTACGTCCTGGTCAAGGACCCCAACAAG
CCCATCCTGCGTTTGTACCAGGTGCCGGCCGGCAGCTTCGAGGACGACGCCGAGGAGGATGTGGTCGAGCCTCCGGTCGA
GGAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62