GenePrediction:GLEAN_761 Details

Name: GLEAN_761
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1942649..1945673 (+ strand)
Length: 3025
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1942649..1942689 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_97:1942748..1943534 (+ strand)
Length: 787
Type: CDS
Source: GLEAN
Position: GCSC_97:1943601..1945673 (+ strand)
Length: 2073
>GLEAN_761 class=GenePrediction position=GCSC_97:1942649..1945673 (+ strand)
ATGGCCGATTCCGAGATTCGACGCCGAAGACGTCCAGCCGTGTAAGTTTCCTTTCCTCTGGCCAGCTGGCTCAAGATGCC
CTAACACGATCCCTTAAAGCTCTTGCGCGCTCTGTCGTCGGCGGAAAATTCGCTGCAATCGCGAACAGCCATGCAACAAC
TGTCTTCGGGCGCGCAAAGATGCTGTTTGCGTTTATGAGGATCTGCCACCGTTGCCACAGCTGCAGCAGTCGGAATCGCA
GCATGGACGAGTGGTGCTGCCAACATCCTATCCCACCGAGCCAGAAGCTGTGGCAGCTCCTCTCCAACCTTCCCCCACAA
CCCTGCCGGGCCAATTCGCGGAGATGCACCCGCCTTTCGACATGGATGCCTCCTTGGGCAAGCCCGCATTCACGGATGAG
GTTTGCGTGGGTCCTGAGACGGCGCTGTCTGACAGCTGCATTCGTCGCGCATTGAGACGACAAATTCGCAAGCTCGAGGC
ACAGCTGCGTGCCGTTCGGCGCAACCAGCAACCACGTCATCAAGGTGCCCCTGCAAGTGCGGGCGTGTCCACAACTGCTG
TTGCCACATCGCCCTCTTCACGCTTGACGCAGCCAGAGCAAAGCTCTCCCAGCCTCAGTCACGAAGCCGATACCGGTACC
GATGTCGATGCCGACTCGCCCCTGTCGCCGGTGTCGCCACCGTTGGACACACCGGCGACGTCGCAGAACCTCGTCCGATC
GGCGGCCGGTTGGACTAGACCCGTCATCTGCGACTCCTTTGCAGGCCAGGGTCACTCGTACACTCGCTGCCAAGGCATTC
CAGGATATGCACAGTTCACGAGCCGCAACGTCATGCACAAGACACGCCTCCTTGGCCAGAGCCACGGTGTCAACAGTGTC
ATGGGGGTATGTAAGAAACAAGAGGCCGGTAAAGAGGCCAGCGACTGAAAGCTTCAGAGGCTGACTGTGCAGTTCCGCGA
CATCTTCGAGTCGATCGAGCTGTCCATCGTGGGCAACAAGCAGAGCAAGGTATTTGTTGACATGCATCGGATCAAGCACC
TCGCCCGCATCATCAAGGCGCAGCGCAGATCCCCGTGGCCAGTCACCCTTCCGAGCTCGCTGGCAGCACGACGCCGCGAC
CTACCGCCGCGTCCTCTGGCCGACCAGCTTGTCCAGTGCTACCTGCGCAGCTCTGAGGGCCTGTTCCGCGTCCTGCATGT
GCCTCTGTTCCAAAAAGACTATGAGGCCTATTGGGCGGATGCTGCTGCTGCTACCGGTTCTTCATCTGCGCCAGACACCG
CCTTTCTGGTGCAGCTGTGCCTTGTGCTGGCCATTGGCACCGCCAGCCACCCCGAACACGTCCGACTGCGCCCCAATGCT
ATCCGCTGGGTACACCAGGCGCTTTGCTGGGCAGCCGAGCCCGACTTCAAGGCACGTCTGACCATCCAGACGTTGCAAAA
CAGCGTCTTGCTGCTGCTGGCACGCGAGGCTGTCGGTGTTGGCACCGACCTGGTCTGGATGGCCGTTGGAAGCCTTCTGC
GCACCGCTGTCTACATGGGCTTGCATCGTGATCCGCTGCTGCTGCCCAAGAGGGCCACTCTCCTGGCTGCCGAGATGCGC
CGCCGCCTGTGGAACACCATCCTGGAGCTGGCTGTTAATACGGGATTATGCGCCGGTGGACCGGTCATGCTATCGCTGGC
TGACTTTGACGCGCAGCCCCCGGGCAATTTTGATGACGAGGAGCTGTTGGGTGGCAATGGTGATGGTGACGGGACCATCG
ATCTTGAGAACTCGACGGAGAACAGGACAAACCTCTCCAAAGAAGGCCGCCCGCCAGACGTCTTCACTCAGACATCTGTG
GCCATCGCGCTGCGCAAAACCTTTCCGCTGCGCCTGGCCATTGTTCACTTTCTCAACGACCTGGAGCCACGCGGCTCATA
TGGTGAGACTTTGCGGATCGACAAGGAGTTCCGAGCTGTATTCCGGGCGCTCTGCCAGACGCTGGATTCGTTCCAGCGCA
GTGCCAATAGCCGCACCGACGGCACCGACGAAAAACCGATTCCTCACGTCCAGCTGGCACTGATCGACCTGCTGATGCGA
CGGCCCCTATTGTGTTTGCACGTCCCCTTTTTCGGCGCCGCCGTGCACGACCTGGCTGCCTATGCCTTCTCTCATCGCGT
CGTCGTGGACACGGCAGTCAAGATCTGGAGCACTAGTACCTGCACTCAAAGCGCACACGACTTCTCTCCGCCGAGCAGCG
CGGCCACGCCAAAGGGCCTCTTTCCACCACCATCCTCCCCTCTTTTCTCCGACCCAGACGAGATCATCCGCATCGCCATG
CTCGGTCCTGGCCCCCTCCGCAATCTGACAGCGCAGGCAAGCCTGCTGGTGGCCGCTGAGATCAAACTGAAGCTGCTCGA
GGACATTGCTCAGGATGGCACGCATCTCATGTCGGCGCTCACCTCATCTGGCCTCCAGTCACCCCTAATTCCCGTTCGGC
CTGACTTGATGACTATTTTGCACAGCGCCCGCGACTGGTCTTTAAAGGCTGTCGAAGCGGGCGAGGTCAACTGCAAAGGG
CACCTATTCTGCTGCCTTGTCCTCGCACAGATTGGTCAGATGCGCCGAGGCATGACGAACCCGGCGAATGCCGCTCCCGA
GATAAAGCTGGCCCTGGCTCACGAGCTTGTGCGCAGCGCCGAGGAGTCACTGGATATGTGTATGCCTTTGATAGAGCGCC
ATCGGGCAGAAGGACAGGCACGCTCGGAGACCGAAGCCAGGGCCGCGGCAGCGGATGGAGAGCTTGAAGGAGCTGCCGTA
GAGATAGCTGCCACGCCTGCTCTTTTTGAAACTGCAAGTACTGCCGCGGCCGCCACAGCTGCCGACGCCGCTAATGCCGA
AGCTAGCCTGTTTACGCGTCAGGATTTCGATGTGATGTCTGATCATATTGAAAACTGGGACTTCCTCATGTCTGACATCC
AGATGTCCGATCTGGGCCGTTTAGGCGATCTGTACAATTGGCTGTTCTCAAACGACTCGACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62