GenePrediction:GLEAN_762 Details

Name: GLEAN_762
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1948328..1949692 (+ strand)
Length: 1365
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1948328..1948422 (+ strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_97:1949425..1949692 (+ strand)
Length: 268
>GLEAN_762 class=GenePrediction position=GCSC_97:1948328..1949692 (+ strand)
ATGCATCACAAAGCGGAAAGGCTGGCCCCGGTCAAGCTAGATGCCGTAGCATCGCCTCCTTCCAACATCGCCGTGCCTCT
ATGTCAAGCAGGTCCGTACGATACGACTTTCCCAACCTGGTTATACGCCGTTTCAAACATGCTGTATAATGCTTAATCAG
CACACCCGTCACCCGTACTATGTAACAGCCCAGCTGACTACTCCAATCATCGACTTCCACGCTCCTCCTCCCACGCTCCA
ACCCCACGCTCATCCAGCCGAAATGGCCGTCGCAACTGTGTACACGGCCAATCTTTCCTTTCTGCTTGGCGTGCATGCAG
ACTACACGTGCCCCCCACGAGCAAATACAGCTTGGGCGGGACTCGCTGCAAGAATGAGTCGTGATTCCCTCGACATTCCC
CCACACGGCTAGAACTTGGATGGACATCTATCCTGGAGAATCTCCCCTTCACATCGGTGTGCGAGAGCAGCAGCAGCTAG
CAGACGGCCTGCCCGACTGCCACCATGAATCATGGGACACTTTCGCCCCCGGTCCCCCACGCTAACGCACCGTTGACAGC
AACAAGTACTCCGTAAGATACGAGCGACTCTCGACATTGGCGAATGTGAGACTGAGGACATGGAAGGCGGGGGGAGGGGG
AGGGGAAGGGGGGGCGAATTACATCCACGTGCTGCCGTTCTTCCGCATGCCGCTTCTGTTTCTTTTTCCAGTTACCTGCC
GTGGTCTTTCTTGCTTTTTATAACTGCTTCAGGCCCGCAGAACGATCCGGTTTTCTCTGCAGATCGCCGCTTTCGCCCTC
CATCCACCGCTTCCCCCCTTTTCCATTCTTCCAGCAGGCTCAGTACACGTATCGCATCGGACATAGTAGGCTCCCAGCAC
CACAACAGCGCAGCAGCACCGCAGCGCCGCAACACAGCCCGCTGAGGCCTTGCAGTTCGACATCACTGATCTTGTTGCTG
CCGTGGACTCTTGCTGGCACGTCTCCACCGCGCCATTTTTCCCGTTTCAGAGCTCGGGTCTCTACGACGTATCTTACGCT
TGGTCATTGCCGGGGCGGTGTGTGTGACTGTTTATTGCTCGACTCTAATTGCGACAGCTGCCGGTTGTTTACCACCCACT
TCGAGTGCTATGCCAGCGACCCATCTGTGTGGGAAAATATGGGCCGGGACCACCCTGCGATGTTTTCTGGGACGGGCTTG
ATTGGCCGGGACAAGGCCATCGAACCACCGTCCCCGTTGTTGTTATGGCAGGCCCACCGCGACCCAAGCAAGTCCGGAGT
CCGGAGTACAGAGTACGTCGACGTCGAACTGCGCTCTTGGCCGCTCCTCGGCTGCCTCTGGGCTCTGTGGCTCTGGGCCC
TGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62