GenePrediction:GLEAN_7634 Details

Name: GLEAN_7634
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:819327..818512 (- strand)
Length: 816
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:819327..819214 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_140:819148..818600 (- strand)
Length: 549
Type: CDS
Source: GLEAN
Position: GCSC_140:818547..818512 (- strand)
Length: 36
>GLEAN_7634 class=GenePrediction position=GCSC_140:819327..818512 (- strand)
ATGGCCATCCAAATCTTGCCTCTGACGGCGGCTAATATTCCGCAAGCCGTGGAGGTCATACAGCAGGCATTTGCAGATGA
CCCCTACTTTCAATGGGCTTTTGACTCGGCCACAGTACGTACTTCTGGTGACAAAACCATGAGATACGGTTGGTGAGAGC
GCTCTGACAAGTTAAACAGTTTAACAAGGAGAGGAACTGCGCATCTCTATCGTCACGATGCCACTGGGGCATATCAAATG
CCATCTTCCACATTGCCAGGGAATCGAGTGAGGCGGGTGAGGACGATGCGAAGACGTCCCGGGTCCTTGGAGTGTCGTGC
TGGCTGCCTCCGCACTCAGCGGCCGAGGCTGAGGGCTGGTACTCGTGGCTTCAGTCCTGGACTCTCTCCTTCAATCAGCT
TCTCAACAACGTGCGCTATCTAGGCCACGGAGGACTGCGCACAAATAGGTACTGGATCTGGAAAGACCGTCAGCGCGAGG
CGCAGTCGCAGATCTGGGACGATCCTCGCGGCTATTATTTTTGCAATATTATTGCCATTCGCCCCGAGGCCCAAGGAAAG
GGCATCGGCCGACGGCTATTTGAGGCCGTTGCCGAACAGACAGATCGCGAAGGGATGAAGTGCTACCTAGAGAGTTCAAA
GCTCACGCCCAACACGGAGATCTACGAACGGCTCGGGTTTCACATGGCCAGAGAGATGGAGTGTCGCGACGGGGATGATG
TCTGCATGGTGAGTGTCAACTCTCGAAAGTATGGGCATCAAGAAACTAACCCTTTGCCAGTTGTATTGCATGGTGCGTGA
CCCGAAGTCGAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62