GenePrediction:GLEAN_7637 Details

Name: GLEAN_7637
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:803742..802300 (- strand)
Length: 1443
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:803742..802300 (- strand)
Length: 1443
>GLEAN_7637 class=GenePrediction position=GCSC_140:803742..802300 (- strand)
ATGGCCCCTCTAGGAGGCATCTGGGTCCCGATGGCCCAGCGCATCCTAAAGCAGGCCTTGTCTGCGGGCGCGCGCATGAC
CGAAGTTGTGCGCATCAACATCTCGGCCGCATCACGGATCAGCCAGGTTCGACTGGAGCCGGCAGCCGTGCGGACGGCCG
TCTCTGGCGGTGGTGTCCGTCAGCCGCTGCACCCGTTCGCTCTGCGCCGTCAGCTCAAGCGCAGCGGCACCCGCTGGTAC
CACGCGCGCCAGACCTCGACCTCGTCCACCCTATCGTTTTCCTTCTCGCCCCGACGCTTCCATGCGGCCGTGCGTCGCTT
CATCCGCACCGGCCGGCCATCCCGCCCTCGTCACGTCGACCGCGCCGCTTTTCTGCAGTCGCCCATCGCCTCGCAGGCTG
TCTGGCGTGCACCCGGCCGCGCCCCCTTTGCGTCGGCGCTGCGGCCCAGCCTGACCGGAGGCGCACTTCCTCGCACGGCT
GGCGGCTATGCGGCCGGTGCAGCTGGTCGTGGTGGTGCCCGCTATTTCTCGCACGCACCCGCAGCACCAGCACAGGTCGT
GCAGAACGTTTCGCAGGCCATGCGCGCCTTCTGGCTGTCGGGCCAGCGCGCCCGCTTTGACGGCACCGATGGCCAAGGAA
GGACCTGCTACAGGGCCATCAGCTCGCTCGAGGAAGAGACTGCCCGTCGTCTCGCTGTGCCAGCTCTGCCTGCGCTAGCG
CCCGGTGCCTTTGTCGACTTTCCCCTGACGCCCACCATCACGGCCTTGGCCCCGCTGATGGCTGCTGGTGTTCGCTCTCG
CTCTGGCTCTGGCTCGGCTTTCCCCAGCAAGATGGCCACCGGCTTTGGCTTCACTGCTGCGCCTGCTGCCACCACCTCTC
CCACCACTCTCAACACCGAAGGTTTCCTCGATGTGCTCGGCGTCGACTTTTCGCGCGCTCTTCAGGAACTCGGCGCCGTC
ATGGCCGATCTCCGACGACTGGCTGGCCTAGGCGACCTGCCCGTGCTGCTCGAGCACGACGCCGTGCTGCGCGTGCGTTT
CCCCGGTGTCGATGCTGTCACTGTCGACCGGCTCTGCGAAGATCTTGGGGTCACGCGCGGGCTTGTCGGCCAGGATCCCG
GCTTTGACACGACCGCCGACGTCACCTTGGCCCTTCGCTTCCCGTTTGCGCCGGACAAGGCCAAGACGGCCTCGTTGACG
TCGCCCGGTGAATCAACACGTGAGTCCTCGGCAATCGACGAAGGTATCTACACCGACTACGACGACATGGACGACGTAGG
TGACCCGTGGCTGCTCTCGCTCCCGCCCAGCCCCCATTCCCACTACGGCGGCCTCGAGCCAGCGGCTGTCTCGTCCGGCC
AGCCCGTCTCGAGCGAGCCTGACGGCTTGCAGGGCGTGTATCGCTTCCTCAAGGCGTGTGATCAGGTGCAAGGACGTTGT
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62