GenePrediction:GLEAN_7639 Details

Name: GLEAN_7639
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:800597..798642 (- strand)
Length: 1956
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:800597..799984 (- strand)
Length: 614
Type: CDS
Source: GLEAN
Position: GCSC_140:799914..798642 (- strand)
Length: 1273
>GLEAN_7639 class=GenePrediction position=GCSC_140:800597..798642 (- strand)
ATGGCCACGCCTTCCGTCGGCCAGCGACTCTCCTACGACGGCGCCATCTGCACGGTGCGCTATGTTGGCCCCGTCGCCGG
CACCTCTGGTGGCCTTTGGCTGGGAGTCGAATGGGACGACCCCAGCCGTGGCAAACATGACGGCGTGCACAAGGGTGTGC
GCTACTTTTCTTGTCAGCTGCGCCAGGTGGCCGGCGGTGGCGGCGGCGCGGCAGCCACGGCCTCGTACACGGCTGCATCG
ACAGCAGCGTCGTTTGTGCGGCCAACGCGGCCAGCCGATCGGACCCGAACCTTTCTCGAGGCCGTTCGGGACAAGTACGC
GTCGACCGAGGCTCCGTCCACAACGTCGTACCGCTTCTCCGGCAAGGTCGCCGAGGAGGTCGGCTTCGAAAAGGTGCGGC
GCCAGATGGCCCAGCTCGAGAGCCTGCGCGTCGTCATCCTTGACAGCATGTGTCTCGATCGAGCCGGTGACGATGACAGA
GAAGACCAGCCATCCATACGCGAGACCTGTCCCTGCATCGCCGAGCTCGATCTCGGCCGCAACCTCTTCACGTCCGTCCG
TGCCGTGGCCGACATCTGCCGCCAGCTGCCCGACCTCCGAAGCCTTCGCCTCAAGTAAGTGCAAAGTACAGACCCCCAAC
GCACTCCCACTTTTCCCCTTGTCTGCTCACTCCACACGTCCAGCAACAACCGGTTCCGGGTCGACGACGACAGCCTCGCT
GGCACCGTCAATGCCGTGCGCGAGCTGTCGGTTGAGGAGACGCTGCTGCCGTGGCTCGACATCAGCCGTCTGACCGCCTG
CTTCCCGGCGCTTGTCTCGCTCAAGGCTGGTGCCAACCAGCTGTCCACACTGCCGCTGTCCATCTCGGCCCCATCGCTGC
CACTCACGCTGACCACGCTGAGCCTTGAGTTCAACGGCTTCACCGCCCTGGCTGACCTCGCCAGCCTCGCCGGCCTGCCT
GTCTTGCACAACCTGCATCTCAAGGGCAACAGCATCGCCACCGTGCAGTCAACAACGTCCGAGAACAAAAACGCCAGCCT
CTCCTTCTCGCCCAGCATTCACTACGTTGATCTCGCCTACAATCGTGTCGCCTCCTGGGACTTTGTCGACGACCTGGCCG
ACGTCTTCCCCGGCCTCTCATCCCTCCGGCTGGCCCACAACCCCGTCTATGACAATCCGGCCCTAGACGACAGCACGGCC
GCTTCCGACAGCTCCGGCAAGAGTAGCCGCATCACTTCAGCTACAGCCTCCGCCGAGGAGGCTTACATGATCACTGTCGC
TCGTCTAGCCGGTCTGCGTACCCTCAACTTCAGCACTGTCACGCCAACAGACCGCGCCAACGCTGAGATGTTCTACCTCT
CGCGCATCGCTCGTCAGATGGCCGCCGTGCCTGAAGGCCCCGCCGAGACTGCCGTCGTAGGCCGTCACCGTCGCTTCTCC
GATCTGTGCGCCCTGTACGGCGAGCCGGCCGTTATTCGCCGCGCCGACGTCAACCCGGCCTTTCTCGAGGCACGCCTCGT
CACCGTGCTCTTCTCCCTGGCAGCGGATCCTCTACAGCAGCAGCTATCTGTGCAGATCCCCCGCTCGTTTGACATGTATG
CCGTCAAGGGCATCGTCGGCCGCCTCTTTGGCACGCCTCCACAGAAAATGCGGCTCGTCTGGGAGACAGGCGAGTGGGAT
CCGGTCACCGGGATCGACGACGACGAAGCTGACGGGGAGGCTGGCGAGGACGAGATTGACGCAGAGGCAGCAGAGCTCGA
GGCAGAGCGAGCCAAAGCCGCTGCAGAGGCAGAAATGGCAGAAAGCGGCACACCTGACGCAACCGACACCGGCCATCACC
ACGGAAACAAAACGGGCCGATGGATTAAGCGAGAAGTCGAGCTCAAAGACAGCCCGCGCCAGTTTGGCTTCTGTGTCGAA
GGCGTCCAGGCCAGGATCCGCGTGGAGGTCCGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62