GenePrediction:GLEAN_763 Details

Name: GLEAN_763
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1952467..1952963 (+ strand)
Length: 497
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1952467..1952484 (+ strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_97:1952552..1952658 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_97:1952726..1952742 (+ strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_97:1952839..1952963 (+ strand)
Length: 125
>GLEAN_763 class=GenePrediction position=GCSC_97:1952467..1952963 (+ strand)
ATGTGTGAATTCACCCAAGTTAGTCTCCCAGCCGCTCTCTGCTGCACTTTCTCCCGTTCTTCGTCCTGACAATGTTTCGT
GTCAGAGAGAATACAGCTGCGGCCATTTCAAGTTCATTGCCGCGCGGTGGTGCAATCTCTACAAGAGAACGCACAGGCGG
TGTCAGCCCGACATCACCCACTTCGAGTACAGGTGAGAAGCAGTTGTCTGTGGAGACTCCACAAGTACCAGGGCAGCCAA
CACTAACATTGTGCGACAGGGCCAACGAAATATGTGGTATGTGCTTCCATCCTGCATCACGAGCCGTCCACTTGTCAACA
TCTCAGCTCTCCGAACCCTCCCACCGATTGCACTGACTGACATCTTTTCCAGGACAATGTCGGCCACAAGAGGTGCCTGA
ATGGCAGCATCTTATCAAGCGTCACACTCCGCACAGTGTGACGGGCATTGCCAGCATCAACAGCCTCGGCGACGTCAGCA
ACACCAAGAAGGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62