GenePrediction:GLEAN_7644 Details

Name: GLEAN_7644
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:762433..761761 (- strand)
Length: 673
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:762433..762265 (- strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_140:762193..762176 (- strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_140:762113..761761 (- strand)
Length: 353
>GLEAN_7644 class=GenePrediction position=GCSC_140:762433..761761 (- strand)
ATGGCTTCCATTGCGCGCACAGCTCTGCTTCGGCAGACGGTCTCTATGGCAGCACCTGCTTCTCGATTCTCGTCCACCAT
CCGCCTGAGCCCGGCAGCTCTGAAGAAAATCTGTGGCGTGGCGGCTTTCCACGCCTCCAGCCGGCGAAACCTGCTGCCGC
CTGGCCCTCGTGAGTAGTCTTCTGGCAACGAGCTAGCAAAAGTCACAGACATGTTGCCCATGCTAACCCAAACGTCCCAG
AGATCGTTCACGGTACCGGTACGCTGCTACACTCCGTCTGGCCACGATGCCGATCTCTGCACATGTACTGACCTGCGCAG
TGAACGATGCCGAGCCGATCCCCGCGTCCGACGCGAGCCACGGCTCCTATCACTGGACGTTTGAGCGGCTCGTCGCCGCC
GGCCTCGTCCCCCTGACACTGGCGCCGTTTGCTGCCGGCTCACTCAACCCGACCACAGACGCGATCCTGTGCGCGACGGT
CCTCGTGCACACGCACATGGGTCTCTCGACCATCCTCGTTGACTACGTGCCGACGTGGGGCTACCCCAAGTTGCGCAAGG
GCCTCACCTGGGGCCTGAACGCCATCACCGCGCTGGTCGGCCTGGGCCTGTACGAGTTTGAGACGAACGACGTTGGCGTC
ACCGAGCTCGTCAGCAAGCTGTGGAAGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62