GenePrediction:GLEAN_7645 Details

Name: GLEAN_7645
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:759664..756876 (- strand)
Length: 2789
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:759664..759422 (- strand)
Length: 243
Type: CDS
Source: GLEAN
Position: GCSC_140:759365..759296 (- strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_140:759186..758964 (- strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_140:758917..758465 (- strand)
Length: 453
Type: CDS
Source: GLEAN
Position: GCSC_140:757995..756876 (- strand)
Length: 1120
>GLEAN_7645 class=GenePrediction position=GCSC_140:759664..756876 (- strand)
ATGGCGGCCTCTACGTCCAGCGGCGATGCCGAGGAGCCGTACGAGAACGACGACCTGGATCCTATTGAAAACTGGGAGGA
TCTGAGCCTGCCGCCTCGCGAGGATGCTACGGGCGTGTGGGAGCATGTGTACGAGCACGGCCGGCGCTTCCACCTCTACA
AACACGGCCGATACCCGATGCCAAATGACCAGCCAGAGCAGGACCGGGAGAACCTGAAGCACCACATGATGCTACTAGCA
ATGGTAGGCCACCAGACTCTCGCTGCCATTGTCGCCAGCCCTGCCTAACAGCCAGCCAGGAAGACAAGCTGTTCCTCGCC
CCGATCGGGGGCAGCCCGCAAAAGATTATCGATATCGGCACAGGCACCGGTAAGTCCGCAGACCGGTCCATCGTCTGAGG
GTTTCCCTTCTGACCCACAGCTTGCCACAGGAATATGGGCCATTGAGAGTTTGTCATGCCCGCCCTGAGTTGGCGCAGAC
GGAGATGCTGACGTTGCAGTGGGCGACAAGTTCCCCGGGGCACAGGTGCTGGGCGTCGACCTGTCCCCGATCCAGCCCGA
ATGGATTCCAGAGAATGTCCGGTTTGTCATTGACGACTGCGAGTCCGACTGGGCCAACGGCTCGGGTTGGGACTTTGCCC
ACTTCCGGGCAATGGCCAGCTACCTGACCCATGCGGACCGGGTGATCGAGAACACGTTCAAGTGAGCATTTGCCTTTCTA
CTTCTGATTCCCCTTGCCTGCTGACAGCCCGAGACACCTGCGGCCGGGCGGATGGATCGAGTTCCAGGAGCTGTACGGCC
ACCCCTACTGCGACGACGGGACCATGCCAGACAGCGACCCTTTACTCGGTTTCTTCGACCTCTTTCTCGACGGCCTAAAG
CTGTTTGGGATGGACCACGACAAGATTCGCAGGCTGCGGGGACCGCTTCGTCGCGCCGGCTTGACCAACATCCAGCTGGT
CAAGAAAAAGATCCCGATGGGGACGTGGCCGCAGGATCCAGCCATGCAGCAACTGGGCCAGTACTTCCGGGCTGTCGTGC
TTGGCGGCCTGCTCGGCGTCACAACCCGGCTCCTGGCCGGTCTCAACCTGACCCAGCTCGAGCAGGAGGTGTGGGTAGCC
AAGGTCAGGCGCAGCCTCGAGGACGACACAATCCACCGCTACTTTTACCTGTACGTTTGGTATGCGCAGAAGCCGGAGGC
GTGAGCAGCGGCGGGGTGGAGGCTTCCATGCACAGAGGCAAACAGTACTAGAAGATGACTAAGAGCTAAGCCAAGAAGCT
CAGGCAGGAGTTGTATGTGCCGTGGAAAGCCATGTGCAACTATAGAATGGTCAAAGCAAACAGGCGTACGGCGTAAAATA
GAATTTGGTTCAAAGTTGTTAGGTATCAAGCTGAGCGTCTACTCCGTACTCTGTAAAGATGGGCTTCCCCAGATTATTGG
ACCAACCAGTGAAGATGTGCTGACTAATATCGCCACCTAGAGCTGTGGCCACTGGAAGGGCGCTATAATATGTAACGAAA
AACAGAGCTGAAGCTCGGCCCTCTGAAGACAGCCACCACCCAAATTTGATTGATCAAGAGCGCGCGCGTCCCGACGACTA
CCGACTACCGACTACCGACTACTGACTTCCGGTTATCCAGACAGTCTGCGCCTGAAGATAGAGTAGCAGGCCCGGGAACA
GCCCCGAGAAGCGATTCGGAAGAAACGGCCTCGACCAGGACGGGGTCATCATGGCCACGATGACACACACGGCGACGGAT
GTTGAGTTGCAGAAGCCGCAGCAGGAGCAGCAGTCGTCGTCGTTTTCGGCCTCGTCGGTGGTGGCCCGTCGGCTGGCGGC
CGGGCTGCTGGCGCACGACCACACGCCGTACGCGTTTGCCTTTACGCCGTTTCTGCAGGCGACATACCACCACGGGCTGG
CGGCAGACCGGTCGATCTGCAAGGCCTACAGCGCAGGCCACTGTCCGTTGGGTCCGCGCTGTCCAGACCGTCACGTGTCG
GCGAGCAGCGGGCACGCGGGCGGTGGTGGCGGACGCGACCGCGAGGGCGGCTTCAACAGCCTCGTCTGCAAGCACTGGCT
GCGCGGTCTCTGCAAGAAGGGCGAGGGCTGCGAGTTTCTGCACGAGTACAACCTGCGCAAGATGCCCGAGTGCAACTTTT
TCCTGCGCAACGGCTTCTGCAGCAACGGCGACGAGTGTCTCTACCTGCACATCGATCCCCGGAGCAAGCTGCCGCCCTGT
CCGGACTATGACGACCGCGGCTTCTGCGCCCTCGGCCCACGCTGTCCCAAGAAGCACGTCCGCCGCCTGCTCTGTCCCTG
CTACCTCGCCGGCTTCTGCCCCAGCGGCCGCGCCTGCAAAGACGGCGCCCACCCCCATTGGGCTGCTGTCGCCGTCGTGG
CTCCTGCTGTCGCCGCGGCCGAGGCTGAGGCTGCCGAGGCTGCCGAGGCTGCCGAGGCTGCTGGCCAAAACCAAAACCAG
GACGGCGAGTATAATCCCTTTGGCCATAGCGGCGCCGGTGGCGACGATGACACCGCCATGGCTGGCACGCCCGATGACGA
CTCCCACCATCACAACAACTTCCACCACTACCAACAACAACAGCAGCAGCATGGAGACGGTGACGACGATCGTGCAGATC
GGTTCGGACAGAACTTCCGCGGCGGGTTCAAGGACAAGTTCGGCAGCGGAGGAGGTCGTGGCACTGGAGGTGGCAGCGGC
AGTGGAGGTGGCCGCTGGAGAGGCCGAGGCGGCGGTGGTGGACGGGGATTTCGAGGCCGAGGCCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62