GenePrediction:GLEAN_7649 Details

Name: GLEAN_7649
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:740890..739142 (- strand)
Length: 1749
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:740890..740851 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_140:740782..740705 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_140:740595..739314 (- strand)
Length: 1282
Type: CDS
Source: GLEAN
Position: GCSC_140:739250..739142 (- strand)
Length: 109
>GLEAN_7649 class=GenePrediction position=GCSC_140:740890..739142 (- strand)
ATGTCGCAGCCCTTGCCCCAAAGCGGTCTGACCGGCACCTGTAAGCAGTAGTCTTCCGTCGTCGTCGTCTAATCCCAAGA
AAGCTCAGACGCTGACGTCACGGTGTAGCAAAGCTCAAGGCCGTGTCCGAGCTGATGCGCCTGCTCACCGCCGATCTTGC
CAGCAGCACACATATGCCGTCCCAGCGTGAGTTGCTGCAGCGAAAGCTTTTGTGCCCCGCTCTATCCCTTCCTCGATTCC
ATGTTGCGCCCGACGGCAGCTGTGCTGCTCAAACGCTAACCGTACCTGCGTGCAGAACGAGATGCAGCTCTGGAAGAGCT
CAAGGTCTACGGTCGCGATCCACGAAACGCAGACCCCATTTTCACGAAAGAGGGCATTGAGACTCTCACGAAACATGCAT
TCAACAGCTCGTCGACCATAACGTCACGGAATGCGCTGCGGTGCTTGGCCAACGCCCTCCTGATAAAACCGGAAACGCGA
CAGATCTTTGTCGACCTCGGCTATGCGCCCAAGGCCTGCAACAAGCTCAAGTCGGCGAATCTGGACACGGAGTTCCTCTT
GTCGAGAATCATCTTCCTGACTACGTACGGCACCAATGTGCAGCTGCAGACGCTCATCGACCAACACCACCTTGCCGATG
CCATTGTGCAGAACCTGGCACGACACGCCAAGCTCTCGGGAAAGAGTGCGAATAACAGCAGCAGCATGATTGCCGGCGCT
GGCGCCGGCAGCAGCTTGGTTGCAAAGGCCAAGGGGAAGGAAACCTCCAAGGCAGACCCCATGGCGGATATGGCGCTGAC
CGAGACGGCCAAGCTCCTGTTTAACGTCACGCACTTCTGCCAGGACCGTGTCGATGCGTTCACGCCGGCGATTGCACCGA
TTGTGACTATGATCTGCAAGCACGACACGCCGCAGCCGAAGCCGCTCGAGGCGCCGGTCAGCTCGCTCGTCAACGCGCTC
CTGACGCTCAACCTCGCCGGCAAGGAGGGCAGCGCGGCGTTGTTTCCAGCCAAGGGCGAGACGACGATGCTTGCAGACCG
GCTCGTGCAGCTGCTGGACCTGGCGCTGCAAAACTACAGCGACACGGAGCTCGACCAGGCGGTGCTGCCGCTGGTGACGG
CGCTGCGCAAGATCTATGAGCTCGCGCCAGCAGACAAAGTGCGGCCGGCGCTGCGTGCCGGCCTGCTGCCCAAGGCGGCA
GACCGCAAGAAGGTGTTGGGGTGGGGTGACACGCTGGCAGCGAAGCTGCTGCGCCACATGACGAACGCGCTGGCGCCAGA
TTTCCGCAACGCGGTAGCACACATGCTGTTTGAGCTGTCGGACAAGGACGCGACCAAGTTTGTGCAGAACGTGGGTTACG
GGTTTGCGTCGGGCTTCCTGTTCCAGAACAACGTGCCGATGCCCGAGGGGGCAACGGAGGCGTTCCAGGCGGCAGCAGCA
GCAGACGGTGACAACAAACGGGTGATCAATGCGATTACGGGCCAGTTCATCGACGAGGAGACGGAACCTGACCTGCCGGA
GATGACGGATGAGGAGAAGGAGCGGGAGGCCGAGCGACTCTTCGTCCTGTTTGAGAGGTGAGAAACGCTACAGCTGATGT
GTTGGTTTGCTGTGCTGAACTAACATTTGCGAATCTCTAGGCTGAGGAGAACGGGTATTGTGAACGTGGAGAACCCAGTT
GCGACGGCATTGCGAGAAGGCCGCTTCCAACAGATAGACGACGACAAGCGGGTGGAAGAGCTAGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62