GenePrediction:GLEAN_7650 Details

Name: GLEAN_7650
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:738206..736855 (- strand)
Length: 1352
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:738206..737211 (- strand)
Length: 996
Type: CDS
Source: GLEAN
Position: GCSC_140:737160..736855 (- strand)
Length: 306
>GLEAN_7650 class=GenePrediction position=GCSC_140:738206..736855 (- strand)
ATGCCTTTTTTTTTCACTGCAGGCCACACGGCCGAGTCGCCGGAATCGTCCAGAGACGCAGCGCTTCCGGTTTCGTCCAA
CGGTGGTGGCGGCGCGCCCAGCTCACCGACACCCGGACATCTCAATGGACAGGACGAGGAGCAGTCGGACGGCAGCGCAG
GCATCGTGGCCGACGACGCGTCGCCAGGGAGGCTGCTGGTGGTCAGCGACCTGGGGGGCGAGTCGGCCGGTGCAGCAGAC
AAGGCGGACGAGAGACGTCGGAGCAACAGCAGCAGCAAGGTGCAAAACGCGATTCGGGCGCAGATGAGCGGCAGCGTGGA
GTTGTCGGATCTGGACGTGATCGGCGGCGGGTCGAGCGATGATGTCGGCGACAAAAACGTCAGCGATGTCGATGTCGGGA
ACGGCGAGGCCGAAGAGGTGAGCGAGATCAAGGAGGCTAAAGAGGTCAAGGAGGTCAGGTCAGCTGCTGGGACGCCATCG
GCAGAGACGTCGGCGGCGACGTCGCCGGTGCCGACTGTCAAGAAGAGGGGCCGGCCGCCGGGTCCGCGCACAATGATGCC
TTCAATAGGTCGGCCGGTTGGCCGACCGCCTGGCAGCCGCGCTCCGATCGCAGTAGCTACGCCGGTTAAGTCTCGACGCA
GACTCTCGGCTCCTATCCCCGTGCCCGGCGCGGCTGCGGCTGCGGCTGTTCTGCAGGCACCGGCCACGGCACCGCGGCGT
TCGCTCAAGCGCCCGGCGGTCGATGAGGCGGCGCCAGCGGCCGAGACGCCAGTTGCAAAGAAGCGCGTGGGCCGGCCGGC
CAAAACAGCCACGACAGCGGCACCGGCACAGGCAAAGAAGACGGCCACCAGCAGCACCAAGACCGCAGCAGTAAGCGGCC
GGGGCCGGGGCAGACCCAAAAAGACTGCCGGCACGGCAGCCACTATTGCACCATCGACAGAAACACGAAAGTCGGTGCGG
ACATTGACGCTGCCCAAGAGAGCTGCCGCCATTGCCGTAAGTGGCTCTGGGATGTTACAGATTGACATGTTACTGACTAC
GAATAGGCGGTCAAGCCAGCGGCCAAGCCAGCGGCCGAGCCAGCTCCGAAAACGGCCAAGACGGCCAAGACGGCCAAGGA
GGCAACAAGCGGGGCCAAGCGGGGCCGCAAGCCGGCTGCAGGCAAGAGCACACCGGAGGTGTACACAGTGGAGGCGATTC
TGGACGAGCGCGTGGATCGCACGACGATGAAGAAGGAGTATCTGCTCAAATGGCAGGGCTTTCCCAAGTCGAAGAGCACG
TGGGAGCCGCAGACACATCTGGTGGGGTGCAAGAAGCTGCTGCGGGACTTTGAGAAGACGAAGAAGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62