GenePrediction:GLEAN_7651 Details

Name: GLEAN_7651
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:736434..733343 (- strand)
Length: 3092
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:736434..735266 (- strand)
Length: 1169
Type: CDS
Source: GLEAN
Position: GCSC_140:735203..734604 (- strand)
Length: 600
Type: CDS
Source: GLEAN
Position: GCSC_140:734298..734253 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_140:734130..733962 (- strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_140:733871..733854 (- strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_140:733803..733739 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_140:733683..733612 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_140:733549..733343 (- strand)
Length: 207
>GLEAN_7651 class=GenePrediction position=GCSC_140:736434..733343 (- strand)
ATGAGACTGAAATTGGCAAGCAGAACGGCACAGTTGGTGCTGGCGGTGCCCGTGCTAGGGGCGATAGCTTTGGCGCCGAG
CCAGCAGCAGCAGCAGCAGCAGCAGCGATTATCAGACGAAGCAGACGGCATCGGCTCAGGCTCCGGCCACAGCCCATTTG
ATGCAGCCTTTGGGGCGCTGGCGGCGAAGACGTTGGCGGCGTGGCGGGTGCCGGGGATAGCGGCGGCGGTGCTGGATGGC
GACGCGACGTGGACGGCGGGCTTTGGGCGCGCGCAGCTGCCAGATGAGCCCGTGACAGCCGACACGCTCTTCTACACGGC
CAGCACGACCAAGGCGTTTGTGGCGGCGACGCTGGGACTGCTGATCGACAGCGGGCAGTACACGGCGGGCGAGGAGACGC
CCCTCGCCTGGTCGACGCCGCTGTCGGCCATCCTGCGCGACGACTTTGTGGTGGCCGACGACGACTGGGCGACAGCGCAC
CTGACGATCGATGATGCTCTTGCGCACCGCAGCGGCCTCGCCGGCCATGACCTGACACGGTCGCGACGCTACGGCCTCGA
CGGTGTCTATCCGGCTGGTGTGCGCGAGGTCACGCGCAGCCTCCGACACCTGCCGTTGACCACGAGCCCGCGCACCGAAT
ACCGCTACTGCAACCTCATGTTTCTCGTGCTCTCACATGCCGTCGAGACTCTTGCCGGTGGCCGCTGGCTCGGCCACATC
CTCCACGACCGGCTCTGGGCACCGCTCGGCATGCGCTCCACCTTCCTCAGCCTCGACCACGCCCGTGCTGCCCCGGCTCC
TGCCTCTCTCGCTCAGGGCTACTACTGGGACGAGGCCGCGACCGTCTACGTGCCCGTTCCCCATATGCCGCTCCACGAGG
TCAGCGGCGCCGGCGGCATTATCTCTACCGTCGCCGACTACGCTCGCTGGCTCCGCTGCTGGATCGACGGCCCGGCAGCG
TCGCGGTCCTCGCCCGCCAACGTTTCAAACGTCTGTGGCGGTATCCCGCTGACCGGCGCCAGCTTCGACCATATCCTCAC
ACCCAAGATCTTCACTACCCAGACAGCCGCCTCGGCTGAGCCGTTTGACGCCCCGGTGGCCTACGCCAGCGCCTGGACCA
CGAGCTCATACCGTGGACATCGCTTCTGGGGCCACTCAGGTGGGAGCAAGTAGGTTTTTCGGAGTGCGTCGTGACTCGTG
ATCGGAACATATATATGCTGACTAATCACAGCGCCTTTGGCGCACAGGTCTACTTCTTTCCTGACGACCGCTTTGGCGTC
GTCCTGTTCGGCAACACGGCCATCACGTCCAACGCGGCCGAGCTCGTGCTGTTGTGGCACCTGGTGGACGAGCACTTTGG
CATTCCGCCAGCAGAGCGCTACGACTGGTCGGCCAAGCTGCGCAGTAAGGCGGCCACACGGGCTGCCCGGTTCGACACAG
CGCTGGACCGCCTATACCCCCAACGCGCGCAACCCCCACTGCCGCCATCGCTGCCGCTGGCCGACTTTGTCGGCACATAC
TACCACCCCGCCTACCAGAACCTCACGCTCCAGCTGATGAAAAGCAATTACAGCGACTACGGGGTCGTCTTTACGGCCGA
GCGTCGGGAGCACACGTGGCCGACGCTGTGCGAATTTGTGCACGTCTCGGGCGACAGCTGGGCCATGTACACGGACATGT
TGTACGAGCGCAGCGGCAACTTCCGCGGCTACGGCCGGGCTCGTTTCCAGGTTGGCGCCGATGGCAGGGCCGGCAGCCTG
GTGGTGGAGTTCTGGGACCGCGACGACGACACGGTCGAGGGCGTCTTTACGTTTGTGCGCATCGATGACATGTGAGCTGT
ATCGCAGGTCAGCAACAGAGATCAAGACAAGAGGCTGTTGTGTACAGTGCAGATGGGGGTGTGCAGGATCAGAAAAGATT
TGTGATGCGTCTCGTTTATCAACAGAAGTTTGATTTGTTCAGTTGGCCGTTCAAAGATAGGATCATCATATGCAGCGTGT
GTAGAAGAGTGTAGGAACAAAACATGGTCTTGTAAACGTACCGGTCAGGCGTGCCCTTCACTATCGGCAAAGGGCGCATG
GAATGGAAAGGCAGAGAGACCGTGTCCCACCGGCTTGAAATTTTCTGACTTTATAGGGAATGGCACATATACTGCCGTGT
GTCTGGCCACCGCCTTTTCCAGGTGAGCTTGTTAGGACGAGACCTCGTCTACAGTGCAGCCGTGCTTGGCCAAGGCCGTA
CCCGCTAACAGACAGTCGCAGCCCACCTCTGCTGTCGCGCCGGGCAACAGCCGACCCCACCTAGGCAAAATCGCGACCTG
TCGAAACCCCGCCAGGCTTCTTGCTCCTCTCCTCGCTTCTGGCTTCTCGCTTCTCGTCTTCTGTCTCTCCTCACCCGCTC
GCCACCACCACGCCCACCAGCGATACGCTCTTCACACCCGCCCACGAAACCACTCTGTCCGACAAGATGGCCGGTGAGTC
TGTCGGCCGGACGGCCGTCGCCCACAGGCCGAAATGGCTCTTCCCAACGATCAAGCTTGGCTAACAGGTCCGATGGCGAG
CAGACTTTCAGACGGTTGCCGGTATGTGTCTTGTCCGTCCTGACAGGCTCCCTCTCGCTGACCGCTGCCAGACCAGTTTG
TGTCGTTCTACTACCAGACCTTTGATGGCAACCGGAAGCAGCTCCAGGCGCTCTACGTACGGACTTGCCCCAACGGCCCT
AGATCTCTCTGACCTTTGACTGACCGAGCAGCGCGACCAATCGATGCTGACGTTTGAGTCGGCGTCCGTCCTGGGTGCTG
CCGCCATCGTGGAGAAGCTGGGGGTATGTGAATGCGATGCAGCCGTCGTCGTTTCCGATCCCCCTGATCCCTGCTGACAA
GACAGAACCTGCCGTTTGAAAAAGTCACGCACCAGGTGTCGACCAAGGACGCCCAGCCGACGATGGACGGCGGCTTGCTC
GTCCTGGTGACGGGCCATTTGCTGATCGACGAGGAGCAGCGGCCGATGGGCTTCTCGCAGGCATTCCAGCTGCTCAAGGA
CGCCAGCGGCTACTTTGTCTACAACGACATCTTCAAGCTGATCTACGGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62